Menu

Experiment on microbiology

1.Medium formulation

LB medium (for E. coli )

• Yeast extract 5 g/L
• Sodium chloride 10 g/L
• Tryptone 10 g/L
• Agar 20g/L (solid）



PDA medium(for B. cinerea )

• PDA medium (potato glucose water AGAR medium, PDA) :
• ddH₂O was added to 46 g PDA medium powder until the total volume was 1 L.

2.Strain culture

• Inoculation of B. cinerea:
• Using a 200μl yellow pipette tip, punch at the edge of the Botrytis cinerea plate, and then inoculate the mycelium plug into the center of the new PDA medium. Incubate in a 21℃ incubator.

In vivo expression and extraction of RNAi

1.Transformation of RNAi plasmid

• (1) Retrieve HT115(DE3) competent cells from -80°C freezer and quickly place them on ice. After 5 minutes, when the cell pellet has thawed, add the desired plasmid and gently mix by tapping the bottom of the Eppendorf tube (avoid using a pipette for mixing). Allow the mixture to stand on ice for 25 minutes.
• (2) Heat shock the mixture in a 42°C water bath for 45 seconds, then quickly return it to ice and let it stand for 2 minutes. Avoid shaking, as it can reduce transformation efficiency.
• (3) Add 700μL of antibiotic-free LB sterile culture medium to the centrifuge tube and incubate at 37°C with shaking at 200rpm for 60 minutes to allow for recovery.
• (4) Centrifuge at 5000rpm for 1 minute to collect the cells. Carefully aspirate approximately 50μL of the supernatant, resuspend the cell pellet by gently pipetting, and spread it onto LB solid medium supplemented with kanamycin (50mg/mL).
• (5) Invert the plates and incubate overnight at 37°C in an incubator.

2.Validation and screening

2.1Plasmid extraction

Pick single colonies from the transformed plate and inoculate them into 20mL of LB liquid medium containing kanamycin (50μg/mL, diluted at a ratio of 1:1000 from a stock concentration of 50mg/mL). Incubate the cultures overnight at 37°C on a shaking incubator. Small extraction: See TIANGEN plasmid small extraction kit.

2.2Polymerase chain reaction

Reaction system：

Reaction process：

2.3Agarose gel electrophoresis

• 1. Dissolve 0.3 g of agarose in 30 mL of 1X TAE solution, heat it until the bubbles stop, and the solution becomes transparent, cool slightly and add 3 μL Goldview (10000x)
• 2. Pour the gel into the gel membrane tool inserted with the comb, and wait for it to set.
• 3.Put the gel into the electrophoresis tank and add 1X TAE buffer to completely cover the gel and squeeze out the bubbles in the gel hole.
• 4. Add the mixed sample and marker to the gel hole. Specific experiments determine the sample loading volume. The marker loading volume is based on the following standards，11 wells gel corresponds to 2 μL, 8 wells correspond to 5 μL, and 6 wells corresponds to 10 μL.
• 5. Run electrophoresis under 180V voltage until the colour band of loading buffer is electrophoresed to the middle or two-thirds of the gel, stop electrophoresis.
• 6. Use ultraviolet light to image the gel. If necessary, cut rubber for recycling.

3.RNA extraction

3.1IPTG induction

• (1) Use a 200μL yellow pipette tip to pick a single colony of HT115 cells harboring the transformed plasmid from the growth on the plate and inoculate it into 4mL (not exceeding 5mL) of LB liquid medium containing kanamycin (50μg/mL, diluted at a ratio of 1:1000 from a stock concentration of 50mg/mL) in a 10mL culture tube (leave the pipette tip in the culture tube). Shake the culture overnight at 37°C.
• (2) Take a small aliquot (as described below) of the above culture (1% inoculum) and inoculate it into LB liquid medium containing kanamycin (50μg/mL) in a culture tube. Shake the culture at 37°C with agitation at 200-300rpm for 3-4 hours (4 hours) until the A600OD reaches approximately 0.6.
  • Small-scale system (for electrophoresis): Add 40μL of the bacterial culture to 4mL of antibiotic-containing medium.
  • Large-scale system (for RNA extraction): Add 500μL of the bacterial culture to 50mL of antibiotic-containing medium.
• (3) Take out 1mL of the sample as the pre-induction sample and store it at -20°C for subsequent RNA extraction and electrophoresis validation.
• (4) Take out 1mL of the remaining samples (same as the control) and add IPTG (0.1mol/L) at a ratio of 1:200 (final concentration of 0.5mmol/L). Shake the samples at 37°C for 4 hours. Store the remaining samples in a 4°C refrigerator. If the sample volume is 1mL, add 5μL of IPTG.
• (5) Transfer the bacterial culture from the culture tubes to centrifuge tubes. Centrifuge the induced bacterial culture at 4000rpm for 10 minutes, discard the supernatant, and collect the bacterial pellet for RNA extraction.

3.2RNA Extraction

Perform all steps on ice!

• (1) Add 1-2mL of Tritol to every 10mL of bacterial culture.
• (2) Vortex for 15s to pellet the cells, then transfer 1mL of the pellet into a pre-chilled centrifuge tube.
• (3) Static 5min.
• (4) Add 400μL of pre-chilled chloroform to the tube.
• (5) Let the tube sit for 3 minutes, allowing the solution to separate into layers.
• (6) Centrifuge the tube at 12000rpm for 15 minutes at 4°C.
• (7) Carefully transfer the upper aqueous phase to a new tube and add an equal volume of pre-chilled isopropanol stored at -20°C. Mix gently.
• (8) Let the tube sit at room temperature for 20-30 minutes to allow RNA precipitation. Alternatively, precipitate at -80°C for approximately 20 minutes for faster results.
• (9) Centrifuge the tube at 12000rpm for 10 minutes at 4°C.
• (10) Discard the supernatant.
• (11) Add 1mL of 75% ethanol (pre-chilled at 4°C) to wash the RNA pellet. Mix by pipetting up and down.
• (12) Centrifuge the tube at 7500rpm for 5 minutes at 4°C. Use a pipette to aspirate the remaining supernatant and air-dry the pellet in a fume hood for approximately 15-30 minutes.
• (13) Add 40μL of DEPC water and use a pipette to dissolve the RNA pellet. (For smaller systems, use 40μL of DEPC water; for larger systems, use 100μL of DEPC water for enrichment to avoid exceeding the detection range during concentration measurement.)
• (14) Measure the concentration of RNA.
• (15) Perform RNA electrophoresis, ensuring that the nucleic acid concentration is around 100 μg/uL.

• 1. Dissolve 0.3 g of agarose in 30 mL of 1X TAE solution, heat it until the bubbles stop, and the solution becomes transparent, cool slightly and add 3 μL Goldview (10000x)
• 2. Pour the gel into the gel membrane tool inserted with the comb, and wait for it to set.
• 3. Add 1/2/3 μL 6× loading buffer to the 5/10/15μL sample and mix by pipetting.
• 4. Put the gel into the electrophoresis tank and add 1X TAE buffer to completely cover the gel and squeeze out the bubbles in the gel hole.
• 5. Add the mixed sample and marker to the gel hole. Specific experiments determine the sample loading volume. The marker loading volume is based on the following standards，11 wells gel corresponds to 2 μL, 8 wells correspond to 5 μL, and 6 wells corresponds to 10 μL.
• 6. Run electrophoresis under 140V voltage until the colour band of loading buffer is electrophoresed to the middle or two-thirds of the gel, stop electrophoresis.
• 7. Use ultraviolet light to image the gel.

• (16)Store RNAi in the refrigerator at -80℃

Product validation experiment

1.Inoculation Experiment

Clean the surface of tomato fruits with 75% ethanol and let them air dry. Place the fruits in an egg carton lined with moist cotton pads. Use a black marker to draw a dashed circle with a diameter of approximately 3mm in the center of each fruit. Within the dashed circle, make five small holes using a sterilized fine needle.

Inoculation with mycelial suspension: Using sterilized forceps, take a suitable amount of mycelium from the B. cinerea agar plate and dissolve it in ddH₂O. Vortex the solution to obtain a mycelial suspension. Inoculate 8μl of the mycelial suspension within each dashed circle on the tomatoes.

Inoculation with mycelial agar discs: Make holes on the edge of the B. cinerea agar plate using a 10μL transparent pipette tip. Place a mycelial agar disc, with the mycelium side facing down, onto the dashed circle area of the tomato.

Spray a certain amount of water inside the box and seal it with plastic wrap to maintain a humid environment. Finally, place the inoculated box in a 21°C incubator for further cultivation.

2.Naked RNAi Treatment

Using a pipette, apply 10μL of the naked RNAi solution onto the surface of the tomato within and around the dashed circle area (spread the liquid as much as possible without letting it flow off the tomato surface). Let the liquid dry, and then perform the inoculation experiment with B. cinerea as described above (preferably using mycelial agar discs). Each tomato should be treated with 10μL of the RNAi system, which contains 10μg of shRNA and 0.1μL of a 500-fold diluted silwet-77 solution. The total volume of the system should be adjusted with DEPC water.

3.CPP-combined RNAi Treatment

Similar to the naked RNAi treatment, but apply 12μL of the CPP-shRNA system onto each tomato. The 12μL system should contain 10μg of shRNA, 0.1μL of a 500-fold diluted silwet-77 solution, and 8.2μL of a 1mg/mL CPP solution. The total volume of the system should be adjusted with DEPC water.

4.RNA Extract tomato sample RNA

For each box of tomatoes, select visibly affected tomatoes from the control group and experimental group. Use forceps and absorbent paper to remove the mycelium on the surface of the tomatoes, which is visible as dark and soft spots. Use a dissecting knife to cut off the affected skin, ensuring that the area removed from each tomato is similar. Place the samples in 2mL EP tubes and add two 4mm stainless steel beads to each tube. Collect the EP tubes in a foam box and pour in a sufficient amount of liquid nitrogen to flash freeze the samples. Finally, store the samples in a -80°C freezer. (When sampling, try to avoid including the flesh and tissues with high moisture content)

• (1) Remove the qPCR samples from the -80°C freezer and place them in liquid nitrogen. Grind the samples in a grinder (42Hz) for 60s and observe the grinding progress. If the samples are not completely powdered, use forceps to slightly crush them before grinding again (42Hz, 60s). Be careful to avoid the EP tubes from breaking during the grinding process. Repeat the grinding process three times. Transfer the powdered samples back into liquid nitrogen.
• (2) Add 1 ml of Trizol reagent to the samples and vortex. Ensure that the total volume of the samples does not exceed 10% of the volume of Trizol. (For 0.1g of plant tissue samples, add 1 ml of Trizol reagent)
• (3) Incubate the EP tubes in an ice bath for 15 minutes, then add 400 μL of chloroform. Vortex for 1 minute, and incubate in an ice bath for another 15 minutes.
• (4) Centrifuge at 12000 rpm for 15 minutes at 4°C. Carefully transfer the supernatant to a new RNase-free 1.5 ml EP tube.
• (5) Add an equal volume of isopropanol, mix well, and freeze precipitate on ice for 30 minutes.
• (6) After the freeze precipitation, centrifuge at 13000 rpm for 20 minutes at 4°C. The pellet obtained is the RNA.
• (7) After centrifugation, discard the upper liquid without pouring out the RNA. Add 1 ml of 75% ethanol and wash the pellet 2-3 times at room temperature, with each wash lasting 5-10 minutes. After each wash, centrifuge at 7500 rpm for 5 minutes at 4°C.
• (8) After the washes, centrifuge briefly at high speed and use a pipette tip to remove excess alcohol.
• (9) Air dry the pellet to allow alcohol to evaporate. Add 40μL of DEPC water and store the samples at -80°C, or proceed with reverse transcription.

5.The synthesis of cDNA

See the kit: TransScript One-step gDNA Removal amd cDNA Synthesis SuperMix（TransGene).

6.qRT-PCR

6.1Reference gene selection

• Bc‐actin‐qRT‐F:5′‐TGCTCCAGAAGCTTTGTTCCAA‐3′
• Bc‐actin‐qRT‐R:5′‐TCGGAGATACCTGGGTACATAG‐3′

6.2Primer Design

6.3Setup of the qPCR system

(1)Configure qPCR system:

(2)Paving of a 96-well plate.

(3)Running the qPCR program.

7.Phenotypic data processing

Lesions were photographed to accurately determine size with the help of ImageJ software. All measurements were referred to the value 1.0 obtained for the shRNA(gfp) treatment. Error bars indicate standard deviations (SD) obtained of at least three biological replicates. All datasets were statistically analyzed via one-tailed un-paired t test (*P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001).

Plasmid construction and expression validation

Plasmid Transformation

• 1.Thawing competent cells: Retrieve 100 μL of competent BL21 (DE3) cells from the -80°C freezer, quickly place them on ice, and let them sit for 5 minutes before thawing.
• 2.Plasmid dilution: After thawing the 4 μg plasmid, dilute it with 400 μL of DEPC water to obtain a 100 ng/μL plasmid solution. Then, take 1 μL of this solution and dilute it 10-fold to obtain a 10 ng/μL plasmid solution.
• 3.After the bacterial pellet has thawed, add the PehA plasmid to it. Gently flick the bottom of the tube to mix it, avoiding pipetting up and down. Let it sit undisturbed in the ice for 10 minutes.
• 4.Heat shock at 42°C water bath for 90 seconds, then quickly transfer the tubes to an ice bath for 2 minutes to cool down. Avoid shaking or disturbing the tubes as it can reduce transformation efficiency.
• 5.Add 700 μL of sterile LB medium without antibiotics to the centrifuge tube. Mix well and incubate at 37°C, 200 rpm for 60 minutes to allow for recovery.
• 6.Centrifuge at 5000 rpm for 1 minute to pellet the cells. Carefully remove and discard the supernatant, leaving approximately 100 μL. Gently resuspend the bacterial pellet by pipetting up and down, then spread it onto an LB agar plate containing the appropriate concentration of antibiotic.
• 7.Invert the agar plate and place it in a 37°C incubator for overnight incubation.

Plasmid PCR

PCR Reaction Setup

PCR Program Setting

To determine PCR products by agarose gel electrophoresis, prepare a 1.5% agarose gel with a total volume of 30 mL. Additionally, use the Takara DL2000 DNA marker and a 10,000x nucleic acid staining solution.

Protein expression validation

Protein function verification

DAB Staining

Soaking method^[1]

In a 4ml system, the leaves were infiltrated with protein at concentrations of 10μg/ml, 25μg/ml^[2], and 50μg/ml for 24 hours, followed by dark treatment in a 1mg/ml DAB solution (pH 3.8) for 24 hours. The leaves were then decolorized in 90% ethanol by boiling for 10 minutes. The leaves were infiltrated with 60% glycerol and photographed.

Dropping method

Protein was dropped onto the same position of the leaves, with final masses of 40μg, 100μg, and 200μg. 10 μl was added at a time, with an interval of 5 minutes between each drop.

The leaves treated by both methods were subjected to grayscale analysis t-test using ImageJ to quantify the intensity of the immune reaction. Each treatment had 9 samples.