Experiments & Study:

Figure 2.3.1 After experimental verification based on E. coli, we replaced the engineered bacteria chassis with probiotics; Modified probiotics are added to foods to help improve intestinal stress in celiac disease.

Perspective of the process of the whole projects:

(1) Biobricks creation —> in E.coli —> in probiotic —> yogurt (to go further)

After the carefully designed, repeatedly verified and continuously improved multiple cycle processes of chassis based on the expression of E. coli, we also learned the characteristics of other strains from the literature research, and planned to replace the chassis organisms with other probiotics if the project can be further advanced - after all, most of the E. coli bacteria are harmful to the human body and easily disrupt the balance of intestinal flora - such as bifidobacteria and Bacillus subtilis (studies have found that gluten-free drinking reduces lactobacilli and bifidobacteria in the gut).
For the probiotic part, application of new engineered probiotics colonizing to the intestinal mucosal layer, regulating the state of intestinal microbiota. After the success of parts I and II, the best adhesion proteins and 33-mer-breaking enzymes will be applied to common factory probiotics, such as Bifidobacterial in yogurt. This part is possible to be tested by digital modeling. In addition, the range of applications can be expanded with computer calculations. That is what our project tries to do against the background of problems with celiac disease, it is possible for engineered bacteria to cut the root of the problem - gluten. Also, it can be used at the outside of the capsule to modify and balance ROS. In the context of cystic fibrosis problems, bacteria can colonize the respiratory mucus layer to help regulate Cl- concentration.

(2) All the protocol follow the steps (click to download)

Plasmid members
Recombinant plasmids
Recombinant bacteria
Gene expression testing
DNA levels
Protein levels

(3) Notebook (click to download)

Material

Bacterial strains: E.coli DH5α (Laboratory collection)
Primers (pairs name, 5’ to 3’ primer sequence)

NO-his.FOR	gttagctgtgatataccatgtagcgtggtgatcagg	36-mer
NO-his.REV	agcggatcctataaacgcagaaaggcccaccc	32-mer
NO_regulater.FOR	ccgcgaaatttaatccttcaatcccagacgtttcg	35-mer
NO_regulater.REV	acatggtatatcacagctaacaccacgtcgt	31-mer
Vector.FOR	gcgtttataggatccgctgctaacaaagc	29-mer
Vector.REV	gaaggattaaatttcgcgggatcgagatct	30-mer

Promoters (name, characteristics(such as: arabinose inducible promoter pBAD), 5’ to 3’ primer sequence)
Imaging systems: Olympus IX83
Microlate readers: INSA machine: Synergy H1 Biotek, Agilent

References

Letourneau J., Levesque C., Berthiaume F., Jacques M., Mourez M. (2011). In Vitro Assay of Bacterial Adhesion onto Mammalian Epithelial Cells. JoVE. 51.
http://www.jove.com/details.php?id=2783, doi: 10.3791/2783
Francis, D. M., & Page, R. (2010). Strategies to optimize protein expression in E. coli. Current protocols in protein science, 61(1), 5-24.

See the Protocol file for details.