Plasmid construction

Reagents:

pET28a plasmid, DNA fragment, primer, Phanta Max Super-Fidelity DNA Polymerase Kit, DNA Loading Buffer, FastPure Gel DNA Extraction Mini Kit, 1×TAE Buffer

Steps:

PCR amplification of gene fragments/preparation of linearized vector

1. Primer design: According to the sequence information of the target gene, the upstream and downstream primers should be designed respectively. The primer should have 15-20 bp on the primer to pair with the target gene template, and the Tm value of the primer should be close to 58℃. When designing the primers for homologous recombination, the homology arm sequence of 15-20 bp should be added to the 5 'end of the primer.
2. Configuration and procedures of the PCR reaction system: Phanta Max Super-Fidelity DNA Polymerase kit from Vazyme was used for PCR in this study. The PCR reaction system and reaction procedures were as follows



Agarose gel electrophoresis

The PCR products were confirmed by agarose gel electrophoresis to confirm whether the molecular weight was consistent with the target amplification fragment, and the enzymes and other reagents in the PCR system were separated to avoid affecting the subsequent experiments. Here's how:

1. Prepare 1% agarose gel: Weigh 0.5 g agarose powder, add 50 mL 1×TAE Buffer, dissolve by heating, add nucleic acid dye and pour into the mold to let cool.
2. 24 μL of PCR product was added to 3 μL of 10×DNA Loading Buffer and subjected to electrophoresis at 150 V for 20 min. DNA markers were used as molecular weight controls during electrophoresis.
3. The luminous DNA bands were observed under ultraviolet light and their molecular weights were compared.

Gel recycling

After confirmation by electrophoresis, the DNA bands could be recovered by gel recovery. FastPure Gel DNA Extraction Mini Kit from Vazyme was used for glue recovery in this study. The steps are as follows:

1. After DNA electrophoresis, the gel containing the target DNA fragment was quickly cut out under UV lamp, and the weight of the gel was weighed. 100 mg of gel was equivalent to 100 μL volume, which was regarded as one gel volume.
2. Equal volume of Buffer GDP was added. A water bath at 55 ° C for 10 min was used to dissolve the gel blocks.
3. The sol solution was transferred to the adsorption column and centrifuged at 13400×g for 1 min.
4. Discard the filtrate, add 300 μL Buffer GDP, and let stand for 1 min. The samples were centrifuged at 13400×g for 1 min.
5. Discard the filtrate and add 700 μL Buffer GW. The samples were centrifuged at 13400×g for 1 min.
6. Repeat step (e), discard the filtrate and centrifuged at 13400×g for 2 min.
7. 30 μL Elution Buffer was added to the center of the adsorption column and left for 2 min. DNA fragments were recovered by centrifugation at 13400×g for 1 min and used for subsequent experiments.

homologous recombination connection

1. The amount of DNA required for recombination reaction was calculated as follows: the optimal amount of linearized vector X = [0.02× linearized vector base pairs] ng; The optimal amount of target gene fragment Y = [0.04× number of base pairs of target gene fragmenting
2. The homologous recombination ligation reaction system was prepared as follows



The reaction was performed at 37 ° C for 30 min to obtain homologous recombination products.

Protein purification

Reagents:

LB medium, ampicillin, IPTG, PMSF, ddH2O, binding buffer, Washing buffer, Elution buffer, Ni NTA Beads 6FF beads.

Steps:

Protein expression in E. coli BL21 cell line

The prokaryotic expression system is the most convenient and economical expression system, which does not require the construction of complex expression vectors or purification of a large number of expression vectors. However, the prokaryotic expression system has some disadvantages such as the inability to modify proteins and secrete proteins. In this study, the E. coli BL21 cell line was used to express intracellular proteins. The procedure is as follows:

1. The constructed expression vector was transfected into BL21 competent cells, and the monoclonal colonies were inoculated into 10 mL ampicillin resistant LB medium and cultured overnight.
2. The overnight culture solution was added to 1 L ampicillin resistant LB medium, incubated at 37 ℃ for 3-4 h in shaking table, and then cooled to 16 ℃.
3. IPTG was added to 100 μmol/L to induce protein expression, and the protein was expressed at 16 ℃ for 16-20 h.

The bacteria were collected by centrifugation of the overnight expressed bacteria solution, and the bacteria were frozen at -80 ℃ for precipitation until use

4. Purification by affinity chromatography

In this study, PslG protein and HMGB1 series protein sequences were constructed in pET28a-6 ×His vector and expressed and purified using Escherichia coli BL21 cell line. The cell precipitation containing the expressed proteins was obtained in the above experiments. In this study, Ni NTA Beads 6FF were used to purify proteins with His tag. The adsorption beads, that is, nickel columns, can bind recombinant proteins with His tag by chelating nickel ions. The combination of recombinant proteins with nickel columns can be competitively eluted by imidazole.

Lysis of bacterial cells: 1×Binding Buffer was added to the collected cell precipitate, cells were lysed and fixed to 40 mL, 400 μL of 100 mM PMSF protease inhibitor was added, and resuspended with shaking until no clumps occurred. The bacterial solution was poured into the material cup of the high-pressure homogenate crusher at 4 ℃ for 500 mPa until the bacterial solution became clear from turbidity. At this time, the intracellular proteins were lysed into the solution. The broken bacterial solution was collected and centrifuged at 18000 rpm for 50 min at 4 ° C to remove bulk cell debris.
Pretreatment of Ni beads: 5 mL NTA wall was added to the gravity chromatography column, rinsed 3-5 times with 5 times the column volume of ultrapure water, and rinsed 1-2 times with 1×Binding Buffer.
Ni beads affinity chromatography: After filtration, the supernatant of the bacterial lysate was added to the chromatography column at room temperature for 30 min to bind the wall. After elution of unbound lysate, the walls were rinsed with 10 times the column volume of 1×Binding Buffer, and after rinsing, the walls were rinsed with 20 times the column volume of nickel column wash litter. After washing, the protein was eluted by 1 times nickel column eluent, which contained the eluted recombinant protein with His tag. The eluent was stored at 4 ℃.

Protein function verification

Reagent & Materials:

1. Proteins from [Protein Purification] part, including A, B, AB, FL, PslG;
2. GB buffer (50mM Tris,150mM NaCl), LB medium, M9 medium;
3. Strain PAO1;
4. Incubator(Thermofisher), enzyme-labeler(Tecan).

[Part1] Buffer replacement

1. Prepare a new buffer GB (50mM Tris,150mM NaCl);
2. Add the protein into a suitable type of concentration tube and centrifuge it to the limit volume by 2300g;
3. Discard the waste liquid, add2ml buffer solution GB to the concentration tube, and centrifuge 2300g to the limit volume;
4. Repeat step 3 twice;
5. Add 2ml buffer GB to the concentration tube, mix with the protein, suck out and store.

[Part2] Inhibition of biofilm growth experiment

Use LB medium to resuscitate PAO1;

The resuscitated PAO1 bacterial solution was diluted to OD600=0.001 using M9 medium and inoculated into 96-wellplates (100ul per well). FL (final concentration 200nM), AB (final concentration 200nM), A (final concentration 200nM), B (final concentration200nM) were added to the treatment group, respectively. PslG (final concentration 50nM) was used to supplement the total volume of solution in each hole to 130ul using buffer GB (50mM Tris, 150mM NaCl), and the control group was directly added with 30ul buffer GB. Cultured at 37℃.

When the culture time reaches 0h, 6h, 12h, 24h, the following operations are carried out: Add 150ul ddH2O for oscillatory cleaning and sucking out (twice), add150ul 0.1% crystal violet solution for dark dyeing for 15min and sucking out, add 200ul ddH2O for oscillatory cleaning and sucking out (twice), add 200ulanhydrous ethanol for dark dissolution for 15min. The OD550 of the sample was detected with an enzyme-labeler and the data was recorded.

[Part3] Biofilm disassembly experiment

1. PAO1was resuscitated using LB medium;
2. The recovered PAO1 solution was diluted to OD600=0.001 using M9 medium, inoculated into 96-well plates (100ul per well), and cultured at 37℃ for 24h;
3. FL (final concentration 200nM), AB (final concentration 200nM), A (final concentration 200nM), B (final concentration 200nM), PslG (final concentration 50nM) were added to the treatment group, and the buffer GB (50mM Tris, 150mM NaCl) was used to supplement the total volume of solution in each hole to 130ul, and the control group was directly added with 30ul buffer GB. Cultured at 37℃.
4. When the culture time reaches 0min, 1h, 2h, 4h, 8h, the following operations are carried out: Add 150ul ddH2O for oscillatory cleaning and sucking out (twice), add 150ul 0.1% crystal violet solution for dark dyeing for15min and sucking out, add 200ul ddH2O for oscillatory cleaning and sucking out(twice), add 200ul anhydrous ethanol for dark dissolution for 15min. The OD550 of the sample was detected with an enzyme-labeler and the data was recorded. a

Confocal microscopy imaging

Reagents:

syto9 stain, HHL stain, M9 medium, LB medium, purified protein, GB buffer, ddH2O.

Steps:

1. Pseudomonas aeruginosa (PAO1) was resuscitated and spread on LB plates. After culturing in a 37 ° C constant temperature incubator for one day, monoclonal colonies were selected and inoculated into LB liquid medium. After culturing in a 37 ° C shaker, the colonies were grown to OD greater than 1, and diluted with M9 liquid medium for a thousand times, 3ml of the diluent was inoculated into cell culture dishes. Mature biofilm was obtained by incubating the cells in an oven at 37 ° C for 48h
2. In the experimental group, 1mL HMGB1_A box (200nM) and 1mL PslG (50nM) (dissolved in GB buffer) were added into the mature biofilm cell culture dish, and then returned to the 37 ° C constant temperature incubator for 24 hours

In the control group, 2mL GB buffer was added into the mature biofilm cell culture dish, and then returned to the 37 ° constant temperature incubator for 24 hours

3. After the treatment, the biofilm was carefully sucked out and discarded, and the biofilm was cleaned with ddH2O. syto9 (staining for eDNA) and HHL (staining of Psl) staining solution were diluted to the working concentration, respectively, and 1mL syto9 and 1mL HHL staining solution were added to each dish at the same time and treated in the dark for 4h.
4. At the end of the treatment, the liquid in the Petri dish was carefully aspirated and discarded, and the biofilm was washed twice with ddH2O.
5. Observation under confocal microscope

Cytotoxicity Test and Inflammation Verification

To verify the safety of the two proteins, we designed two experiments in this section, cytotoxicity test and inflammation verification. The cell line we used was HT-29 (American Type Culture Collection, ATCC). LPS was purified from E. coli O111:B4 (Beyotime). The technique we used to test toxicity was trypan blue staining. In terms of the inflammation verification, we first extracted total RNA from the cells and then carried out the reverse transcription followed by qPCR, in order to detect the expression of 2 major pro-inflammatory cytokines - TNF-α and IL-1β.

Section 1: Cell Culture

1. Take out a 60mm cell culture dish, and seed 5×106 HT-29 cells in 5 mL McCoy's 5A complete medium (Components: McCoy's 5A + 10% fetal bovine serum + 1% Penicillin/Streptomycin).
2. Incubate at 37°C with 5% CO2 until the confluence reaches 90%. All reagents should be pre-warmed at room temperature.
3. Afterward, wash the cells three times with 2 mL phosphate buffer solution (PBS) in preparation for the experiment.
4. In terms of subculture, add 1 mL 0.25% Trypsin-0.02% EDTA (mixed in PBS with phenol red) and wait for 5 minutes.
5. Use 3 mL complete medium to terminate digestion, and collect all the cell suspension into a 15 mL centrifuge.
6. Centrifuge at 1,000 rpm lasting 5 minutes.
7. Remove the supernatant and add 1 mL complete medium to resuspend the cells. Then transfer cell suspension to another petri dish at a specific ratio.

Section 2: Cytotoxicity Test

1. Incubate HT-29 cells until the confluence reaches 90%.
2. Add specific substances to the medium and incubate at 37°C with 5% CO2 for 24 hours.
3. Trypsinize the cells and make the cell suspension according to Section 1.
4. Mix 10 μL of the cell suspension (diluted if needed) with 10 μL 0.4% trypan blue solution in a 1.5 mL centrifuge tube.
5. Mix the suspension, add 10 μL mixture to the hemocytometer, and count the cells. Count both the live cells and dead cells, then calculate the survival rate.

Section 3: Inflammation Verification

Extract Total RNA

1. Incubate HT-29 cells until the confluence reaches 90%.

2. Cell Lysis:

   1. Discard the culture medium and wash once with 1 × PBS.
   2. Add 1-2 mL of RNAiso Plus (TaKaRa) to each 10 cm2 of the cell growth area, gently shake to ensure even distribution of the lysis solution on the cell surface (a 60 mm culture dish has a growth area of 21 cm2 and can use 3 mL).
   3. Transfer the lysate-containing cells to a centrifuge tube, and repeatedly pipette up and down until there is no obvious precipitation in the lysis solution.
   4. Allow it to stand at room temperature (15-30°C) for 5 minutes.
3. Add chloroform (1/5 volume of RNAiso Plus) to the homogenized lysate from the above step. Seal the centrifuge tube tightly, mix until the solution becomes milky white, and let it stand at room temperature for 5 minutes.
4. Centrifuge with 12,000 g at 4°C for 15 minutes. Carefully remove the centrifuge tube from the centrifuge. At this point, the homogenate separates into three layers: a colorless upper aqueous layer (containing RNA), a white middle protein layer (mostly DNA), and a colored lower organic phase.
5. Aspirate the upper aqueous layer and transfer it to another clean centrifuge tube (do not aspirate the white middle layer).
6. Add isopropanol at 0.5-1 times the volume of RNAiso Plus to the upper aqueous layer. Invert the centrifuge tube several times to mix thoroughly and let it stand at room temperature for 10 minutes (if RNA quantity is low, 1 μL of glycogen dye can be added after adding isopropanol).
7. Centrifuge with 12,000 g at 4°C for 10 minutes. After centrifugation, RNA will precipitate at the bottom of the tube.
8. Carefully discard the supernatant without disturbing the precipitate. A small amount of residual isopropanol is acceptable. Add an equal volume of 75% ethanol to the precipitate, gently invert the centrifuge tube to wash the tube wall, and centrifuge with 7,500 g at 4°C for 5 minutes. Carefully discard the supernatant without disturbing the precipitate.
9. Remove the centrifuge tube cap and air-dry the precipitate at room temperature for a few minutes. Once the precipitate is dry, add an appropriate volume (20 μL) of RNase-free water (DEPC water) to dissolve the precipitate.
10. Measure the RNA concentration, loading 1 μL each time for analysis on the instrument (NanoDrop).

Reverse Transcription

1. Removal of Residual Genomic DNA
   Prepare the following mixture in an RNase-free centrifuge tube and gently mix by pipetting up and down. Incubate at 42°C for 2 minutes.

   

2. Reverse Transcription Reaction Setup (20 μL reaction)
   Directly add 4 × Hifair III SuperMix plus (YEASEN) to the reaction tube from Step 1 and gently mix by pipetting up and down.

   

3. Reverse Transcription Program Settings
   

   

[Note]: Recommended reverse transcription temperature is 55°C. For templates with a high GC content or complex templates, the reverse transcription temperature can be increased to 60°C. Reverse transcription products can be used immediately for qPCR reactions or stored at -20°C for short-term use. For long-term storage, it is recommended to aliquot and store at -80°C to avoid repeated freeze-thaw cycles.

Real-time Fluorescent Quantitative PCR

1. Design the primers for human IL-1β and TNF-α genes. The HT-29 cell cDNA obtained in the above steps was used as the template for real-time fluorescence quantitative PCR experiments.
2. Reaction System:
   

   

3. Reaction Program Settings:
   

   

4. The relative mRNA expression was calculated by the 2^-ΔΔCt method to demonstrate the amplification ratio of inflammatory cytokine genes in different cell treatment groups relative to the internal reference genes.

Quorum sensing system

Characterization of pTetR-LasR-pLuxR-GFP with 3OC12HSL

Single colonies of pTetR-LasR-pLuxR-GFP (BL21) were each inoculated into 5 ml of prewarmed supplemented M9 ampicillin for overnight culture in a shaking incubator at 37℃. After overnight growth, the cultures were diluted to OD600 of 0.002 and allowed to incubate further to OD600 of 0.5 under the same condition. Cultures were then transferred into a transparent, flat-bottom 96-well plate in triplicate aliquots of 200 ml for induction with 3OC12HSL at varying molar concentrations (5e-9, 1e-8, 2.5e-8, 5e-8, 1e-7, 5e-7, 1e-6, 5e-6, 1e-5). The plate was incubated at 37℃ with rapid shaking in a microplate reader (Biotek) and assayed for green fluorescence. Time-series fluorescence and OD600 data were obtained at intervals of 10 m fora total run time of 3 h. The result was zeroed with supplemented M9 to remove background fluorescence and OD600. A relative GFP production rate was derived as a ratio of background subtracted green fluorescence to OD600 value. A time-averaged GFP synthesis rate was obtained by averaging the relative GFP production rates between 20 and 80 m after induction with 3OC12HSL. The experimental results were fitted using an empirical mathematical model (Hill equation),

The equation models GFP synthesis rate (y) as a function of input concentration of 3OC12HSL ([C12]). The four parameters (A, B, C, n) were estimated to obtain the best fit curve by performing a non-linear curve fitting using the experimental results. This curve fitting was performed using Origin.

Arabinose-induced cell lysis

Reagent & Materials:

1. Arabinose, glucose;
2. Strain BL21;
3. Incubator (Thermofisher).

[Part1] The growth curve induced by arabinose

1. The bacterial solution with OD600 absorbance of 2 was diluted 1:100 and divided into four groups;
2. Cultured at 220 RPM at 37℃ until theOD600 absorbance reached 0.5, three groups were induced by adding 1%,0.1% or 0.01% arabinose, while the control group was inhibited by 0.2% glucose;
3. Put it back to 37℃ for cultivation at 220rpm, detect the OD600 absorbance every 15min, and draw a curve.

[Part2] DNA concentration detection of supernatant

1. The bacterial solution with OD600 absorbance of 2 was diluted 1:100 and divided into three groups (induction group, non-induction group, physical cracking group);
2. Cultured at 220 RPM at 37℃ until theOD600 absorbance reached 0.5, the induction group was induced by adding1% arabinose, and the supernatant of the induction group and the non-induction group was centrifuged after 5h;
3. Repeated freeze-thaw of the physical cracking group: liquid nitrogen is frozen, stored at -80℃ for 30min, and thawed with 99℃ metal baths after removal;
4. Repeat step 3 twice;
5. Physical cracking group centrifuge supernatant. Three DNA concentrations were measured, data collected and compared.

Future Plans

Introduction

Many Gram-negative bacteria have a macromolecular complex called the type II secretion system (T2SS) that spans the cell envelope. It belongs to a much larger superfamily of systems that comprise type IV filaments and share homologous parts and conserved mechanistic principles. These include the archaeal T4 pilus, the type 4a and 4b pilus, the tight adherence (Tad) pilus, the competence pilus, the mannose-sensitive hemagglutinin pilus, and the flagellum. Phylogenetic investigations indicate a lineage split from the last universal common ancestor (LUCA), and these systems are ancient and crucial to both the bacterial and archaeal kingdoms. The T2SS is definitely present in ECN and is particularly concentrated in the Alpha-, Beta-, Gamma-, and Delta-proteobacteria, the Bacteroidetes, and the Deferribacteres. The T2SS substrate transport pathway consists of two phases, the first of which is carried by the Sec or Tat protein export pathway from the cytoplasm to the periplasmic space and stays there for a while until a signal is received that activates the secondary export of the substrate. To target to either the Sec or the Tat (twin-arginine translocation) protein export pathway, proteins that are found outside the cytoplasm must be produced with amino-terminal signal peptides. The Tat pathway transports proteins that have already folded, whereas the Sec apparatus translocate polypeptides in an unstructured state. This is the primary functional distinction between these two export systems. The Sec pathway is fundamental, universally conserved, and typically the primary channel for protein export. Contrarily, only a small number of organisms have been discovered to require the Tat route, at least under normal laboratory settings. It is present in some bacteria and archaea but not all. The Tat pathway, which enables the effective export of tailored proteins to microvirus/biofilm lesion sites, is fortunately present in ECN by natural means.

Steps

1. Design the primers

The T2SS is a macromolecular complex that spans the cell envelope of many Gram-negative bacteria. It is part of a much larger superfamily of type IV filament containing systems all of which share homologous components and conserved mechanistic principles. These include the type 4a and 4b pilus, tight adherence (Tad) pilus, mannose-sensitive hemagglutinin pilus, competence pilus and archaeal T4 pilus and flagellum. These systems are ancient and fundamental to both bacterial and archaeal kingdoms with phylogeny analyses suggesting a lineage split from within the last universal common ancestor (LUCA). The T2SS is particularly concentrated in the Alpha-, Beta-, Gamma- and Delta-proteobacteria, the Bacteroidetes and Deferribacteres and for sure, this secretory system exists in ECN. In T2SS, the substrate transport pathway consists of two phases, the first of which is transported from the cytoplasm to the periplasmic space via the Sec or Tat protein export pathway and remains there for a period of time until a signal is obtained that activates the secondary export of the substrate.

It is necessary for proteins that are located outside the cytoplasm to be synthesized with amino-terminal signal peptides so that they can target to either the Sec or the Tat (twin-arginine translocation) protein export pathway. The key functional difference between these two export systems is that the Sec apparatus translocates polypeptides in an unstructured state, whereas the Tat pathway transports proteins that have already folded. The Sec pathway is universally conserved, essential and normally the main route of protein export. The Tat pathway, by contrast, is found in some, but not all, bacteria and archaea and has been identified as essential (at least, under standard laboratory conditions) in only a few organisms. We are fortunate that ECN naturally possesses the Tat pathway, which allows for the successful export of designed proteins to microvirus/biofilm lesion sites.

After researching the typical signal sequence of Tat export pathway, according to the Amino Acid Codon, we simply designed two signal sequences for exporting and processed codon optimization that would increase translational efficiency via website.

Seq 1:
AUGTTTCAGGCCAGCCGCCGTCGCTTCATCAAAGCGAGCCCGATCGCACTGTGCGCTGGTGCGGGTGCAGTTCCGCTGCCACGTGCTACCGCG
Seq 2:
AUGTCCCTGTCTCGCCGTCAGTTCCTGCAGGCATCCCCGATTGCACTGTGTGCTGGCGCTGGTGCAGTACCGCTGAAGAGCAAGGC
Considering the length of the primer, we choose the shorter one as our final signal sequence.
Primer F: Tm = 51℃
AAAAGGATCTTCACCTAGATC
Primer R: Tm = 48℃
TGATAATCTCATGACGTGTTCCAGGCAGGTAGGTGGCGGTTCGTTCAGACGAGCCCAGTTGCGCTGGGTACACGGACCTGGGCAGTTAC
GTTCCAGGGCGAAGCTCAAAATCCCTTAACGTGA

2. PCR

We simulated the results of PCR and showed that this design is feasible. After PCR, we send the plasmid for sequencing to make sure that there’s no mistake on base pairs.

3. Protein purification

We will conduct transformation in DH5α competent cells to get more engineered plasmids. Meanwhile, BL21C is used to purify proteins. After incubation, we collect suspension(because our targeting proteins will be secreted outside the cells according to the signal peptide), which contains our proteins. The protein also has GST tag. Thus we use GST beads to purify the proteins.

4. Test

SDS-PAGE and Western blotting are used to examine whether the proteins are secreted. By test the mRNA quantities, we can calculate the secretion efficiency.

Reference

1. Costa, T. R. D., Felisberto-Rodrigues, C., Meir, A., Prevost, M. S., Redzej, A., Trokter, M., & Waksman, G. (2015). Secretion systems in Gram-negative bacteria: Structural and mechanistic insights. Nature Reviews Microbiology, 13(6), Article 6. https://doi.org/10.1038/nrmicro3456