Our iGEM team designed and constructed the full HIV-1 RRE gene, the HIV-1 Rev full-length amino acid sequence, and designed its vector, which included PMV and RRE reverse primer sequences. To ensure that the HIV-1 RRE target gene is ready for amplification, we designed and determined primers optimized to the best.

c) PMV Forward Primer: 5’GTAACCCACTCGTGCACCCAACTGATCTTC3’

RRE Reverse Primer: 5'GGTAGCATTCCAAGGCACAGCAGTGGTG3’

The PCR process was used to react the specifically designed primers, enzymes and constructed plasmid vectors in order to obtain the target gene fragments of HIV-1 RRE. Sequencing results showed that HIV-1 RRE was successfully cloned, in which the gene length was 708bp.

Fig. 2. a) Agarose electrophoresis of the target gene of HIV-1 RRE; b) PCR reaction process of the target gene of HIV-1 RRE; c) The target DNA gene of HIV-1 RRE

DNA transformation, plate coating, and sequencing of the designed and constructed HIV-1 Rev vector indicated that the HIV-1 Rev vector was successfully cloned.

Successful acquisition of HIV-1 RRE RNA for in vitro transcription is firstly to obtain high quality HIV-1 RRE template after optimized PCR process and primers by constructed and prepared plasmid. The construction has been shown in Figure 2 that the HIV-1 RRE target gene after PCR is accurate and has clear bands, which can be the condition for HIV-1 RRE template preparation. Therefore, we will carry out the PCR process through the same conditions to prepare enough HIV-1 RRE template as the key substrate to realize in vitro transcription to obtain HIV-1 RRE RNA.

Protocol

1. The synthesized primers are dissolved in ddH2O after a short period of discovery in a laboratory and stored at -20°C in a 100 µM storage solution. Dilute the primers to 10 µM of working solution before use.

2. Configure the following PCR system in the PCR center and mix well (Note: Reagents are added in the order shown in Table 1).

3. Place in a PCR instrument and run as follows: 95°C for 3 min; 95°C for 15 sec, 63°C for 30 sec, 72°C for 30 s, and 72°C for 5 min.

The PCR products were then run in the PCR instrument for 3 min at 95 °C, 15 sec at 95 °C, 30 sec at 63 °C, 30 s at 72 °C, 30 cycles at 72 °C, 5 min at 72 °C, and held at 4 °C.

4. The PCR products are removed and analyzed by agarose electrophoresis.

After testing and stabilizing HIV-1 RRE DNA template preparation, HIV-1 RRE RNA was obtained by in vitro transcription, and high quality and stable HIV-1 RRE RNA was obtained by isolation and purification, thus realizing a stable in vitro transcription RNA process.

Protocol

1. Reagent thawing

Optimized T7 RNA Polymerase freezing tubes were briefly centrifuged on ice; thawed 10× Transcription Buffer and 4 ribonucleotides (ATP, CTP, GTP, UTP) were mixed and centrifuged to the bottom of the tubes and set aside on ice; and 10× Transcription Buffer was placed at room temperature.

2. Configure the transcription reaction system at room temperature

The reaction system was prepared according to the following system (Reaction volume will be 100μL so add 62μL of water ).

3.Incubate at 37°C for 1.5h and transcribe to obtain HIV-1 RRE RNA

The above reaction solutions were mixed well, briefly centrifuged to the bottom of the tube, and incubated at 37°C for 1.5 h. The transcript length was 358 nt, and the length of the reaction was critical to the quality of the transcription.

Note: It is recommended to use RNase-free tips and EP tubes, wear disposable latex gloves and masks, and prepare all reagents with RNase free H2O to prevent RNase contamination during the experimental procedure.

4.Molecular sieve purification of HIV-1 RRE RNA

The obtained transcription products were first precipitated by centrifugation at low temperature and high speed, the purpose of which was to remove unreacted template DNA and possible white precipitate of the reaction products (this is the formation of magnesium pyrophosphate from free pyrophosphate and magnesium ions in the reaction solution during the reaction process); and then purified to remove free pyrophosphate and so on by Supedx200 molecular sieves, and then replaced into the desired preservation buffer HEPES buffer containing 6 mM Mg2+. The target RNA fractions were collected and subjected to gel electrophoresis to verify the quality of nucleic acids, and Nanodrop to measure the concentration and then sorted for use.

Over-expression of HIV-1 Rev protein and optimization of the isolation and purification process as a means to obtain stable monomeric Rev proteins. and to provide stable samples for interaction with HIV-1 RRE RNA.

Protocol

A.The successfully cloned HIV-1 Rev plasmid was transformed into E. coli DH5α cells for single colony culture.

1. Remove the DH5α sensory cells from the -80℃ ultra-low temperature refrigerator and place on ice for 5min, thaw. 2.

2. Add the target HIV-1 Rev DNA (10ng, <10µl) to the suspension of receptor cells, gently rotate the tube to mix the contents, and place the tube in an ice bath for 30min.

3. Place the tube in a 42°C water bath for 90s, then quickly transfer the tube to ice for 3min.

4. Add 900µl of sterile LB medium (without antibiotics) into the centrifuge tube, mix well and incubate at 37℃ with shaking for 1h (220rpm/min).

5. Centrifuge the transformed sensory cells at low speed (5000rpm, 4min), discard part of the supernatant, keep 100µl of medium, gently blow the suspension with a pipette, and then add all of them to the LB solid agar medium containing the corresponding antibiotics, and spread the cells uniformly with a sterile applicator.

6. Place the plate at room temperature until the liquid is absorbed, invert the plate and incubate at 37℃ for 12-16h, after the appearance of single colonies, store at four degrees for spare use (see Figure 3a).

B.HIV-1 Rev protein overexpression, isolation and purification.

Protocol

1. Select the single colony in A to 100ml of the corresponding resistant sterile LB medium, 37℃ shaker 220rpm/min overnight culture 16h.

2. After measuring OD600 in 0.6 of the overnight culture, take 15ml of the bacterial solution to 1L and add it into the corresponding resistant sterile LB medium, incubate at 37℃ with 220rpm/min until the OD600 is at 0.6-0.8, and start to induce the expression of the target proteins with 1mM IPTG, and continue to incubate at 16℃ with 220rpm/min for 12-16h.

3. Cell fragmentation: collect the bacterium by centrifugation, weigh the wet bacterium, add the lysis solution and protease inhibitor, and perform ultrasonic fragmentation to release the protein.

4. Collection of protein solution: Collect protein solution by centrifugation at high speed to remove cell debris.

5. Purification: Crude purification of target protein using Ni column and gradient elution of heterogeneous proteins using different imidazole concentrations, and finally elution of target protein with high concentration of imidazole.

6. Dialysis: The target protein eluted with high concentration of imidazole buffer was dialyzed overnight to remove imidazole.

7. Molecular sieve purification: The dialyzed proteins are further purified by Superdex75 columns, replacing its buffer with the same buffer used for HIV-1 RRE RNA preservation to prevent RNA degradation or protein aggregation/degradation due to buffer inconsistency.

8. Collect the protein fractions, measure their concentration, and freeze them.

The HIV-1 RRE RNA, which was successfully prepared for testing, was subjected to gel migration electrophoresis experiments with HIV-1 Rev proteins through a series of RNA-to-protein ratios as a means of verifying the interaction between the two.

Protocol：

1. 20µl of HIV-1 RRE RNA and HIV-1 Rev protein were configured with n(RNA/Rev) of 1:12.5; 1:25; 1:50; 1:75, respectively, and after mixing them well, they were placed on ice for 40min for reaction, and then 8% TBM gel was used for the gel migration experiment.

2. The results of gel migration experiments were analyzed.

In our iGEM project, our team investigated the preparation of HIV-1 RRE DNA templates, in vitro transcription, isolation and purification, and HIV-1 Rev protein overexpression, isolation and purification, as well as the interactions between the two, and the results showed that not only did each member of our wet-lab experiment obtain a uniform, high-quality, and stable HIV-1 RRE DNA template, but also obtained a single, tight, and high-purity RNA band in the bulk RNA transcription and purification, and obtained the effective target protein we expected in the HIV-1 Rev overexpression and isolation and purification. The results showed that each member of our wet experiment not only obtained a uniform, high quality and stable HIV-1 RRE DNA template, but also obtained a single, tight and high-purity RNA in batch transcription and purification, and then obtained the effective target proteins in HIV-1 Rev overexpression, isolation and purification, and successfully realized the interaction between the HIV-1 RRE RNA and the HIV-1 Rev protein. These successful experimental results and experiences will provide valuable experience for the design of other viral RNA and protein studies. Meanwhile, these will not only provide a reliable reference for RNA vaccine development and nucleic acid integrase inhibitors, but also provide an effective molecular mechanism for drug development that alters viral RNA load and interaction sites.