For Lactoferrin, After conducting the Literature Review, we found the Lactoferrin structure in Saliva in RCSB database, 1IFG, a polymeric structure.

We finalized these structures for running Molecular Dynamics Simulations, and reviewed the iGEM registry, and we found a part for Lactoferrin Aptamer, The following Sequence is the iGEM registry, gcaggacaccgtaacacgggcttttgctttatcgtaccctttatgctagattgtcctgc

For every sequence, we employed the help of Web Servers to construct 2-D and using that, 3-D Structures for the Aptamer, like Mfold for 2-D, and Xiao Lab for 3-D structures.

We performed Molecular Docking for the Protein-DNA Aptamer system using Molecular Docking using HADDOCK 2.4 server, accessing their highly effective Protein-Nucleic Acid Docking. We conduct Molecular Docking to find the best possible docking posse and evaluate the structures for MD Simulation.

Using the plots like Energy v/s Interface-RMSD, Vanderwal Forces v/s i-RMSD, and HADDOCK Score v/s i-RMSD, we can easily conclude that Cluster 1 contains the best confirmation for Molecular Dynamics analysis of Protein-DNA Aptamer binding.

MD Simulation, We use the software GROMACS, on a Linux-Ubuntu system powered by NVIDIA GPU. The input files for the same were generated through the CHARMM-GUI web server, where we had to set-up the input Simulation conditions, and generate grid-box, by giving input coordinates for the same.

For Lactoferrin, we picked the simulation time to be 50 ns. We simulated the three structures present in the simulation, in a 0.15M KCl solution, as per pre-existing Literature work on the same.

After finishing the simulation of all three structures,

As you can see the spike in RMSD values, the 3rd Structure is relatively unstable compared to 1st and 2nd Structure in the simulation, This information can be further confirmed using RMSF values for structures,

Relatively, Aptamer binds more tightly in the 1st Structure, according to the RMSF data. We can also analyze the Gyration radius data to see how much Aptamer is stable in its conformation.

As we can clearly see, The Radius of Gyration for Structure3 is changing overly as the simulation progresses(Highlighted in Green), But the Structure 1 and 2 is relatively stable throughout the simulation.

Now, we can compare Structure 1 and Structure, by checking the average number of Hydrogen Bonds throughout the simulation, as Hydrogen Bonds help in establishing the stability of the structure.

Here, we can clearly see that Structure 1 and 2 have nearly identical average number of Hydrogen bonds, hence we cannot directly compare the two based on the computational data that we have generated through simulation.

After conducting the Literature Review, we found two particular structures for Amyloid Beta, in both Monomeric and Fibril-like form, PDB ID’s 1IYT and 5KK3. 1IYT is the monomeric structure while the 5KK3 is a Fibril-like structure. We finalized these structures for running Molecular Dynamics Simulations, and reviewed the Literature to find the DNA Aptamer for the best binding structure.

The Following Aptamers were shortlisted for final screening regarding the Aptamer selection for Amyloid Beta-42,

T-SO530 GGTGCGGCGGGACTAGTGGGTGTG

T-SO552 GCGTGTGGGGCTTGGGCAGCTGGG

T-SO504 CAGGGGTGGGCAAAGGGCGGTGGTG

T-SO508 GCCTGTGGTGTTGGGGCGGGTGCG

DNA aptamer Aβ7-92-1H1 (Aβ-Apt, CCGG TGGG GGAC CAGT ACAA AAGT GGGT AGGG CGGG TTGG AAAA)

For every sequence, we employed the help of Web Servers to construct 2-D and using that, 3-D Structures for the Aptamer, like Mfold for 2-D, and Xiao Lab for 3-D structures.

After further screening established on Literature reviews and past experiments, DNA Aptamer and T-SO508 are the most probable candidates for our analysis. This was further confirmed by the process of Molecular Docking using HADDOCK 2.4 server, accessing their highly effective Protein-Nucleic Acid Docking.

By the means of Haddock Docking score, we eliminated the possibility of using other Aptamers than our selected ones.

We also conduct docking analysis of DNA Aptamer and T-S0508 to find the best possible docking posse and confirmation for further Molecular Dynamics Analysis. Here, we use the Centre of Mass constraint in the docking server, and obtain HADDOCK plots and Clusters.

For 1IYT, the possible clusters for docking containing different confirmation were plotted for various thermodynamic parameters.

Using the plots like Energy v/s Interface-RMSD, Vanderwal Forces v/s i-RMSD, and HADDOCK Score v/s i-RMSD, we can easily conclude that Cluster 8 contains the best confirmation for Molecular Dynamics analysis of Protein-DNA Aptamer binding.

Similarly extending the same analysis for the DNA Aptamer, we can easily select the best cluster for that too.

In this case, we can clearly see that there is just one cluster which has the best conformations for Docking, so we can easily pick Cluster 1 structures.

MD Simulation, We use the software GROMACS, on a Linux-Ubuntu system powered by NVIDIA GPU. The input files for the same were generated through the CHARMM-GUI web server, where we had to set-up the input Simulation conditions, and generate grid-box, by giving input coordinates for the same.

We also initiated the Self-Run of Protein, that is to analyze the stability of Protein, in the simulation condition, to understand any potential change in conformation or sudden spike in any parameter which doesn’t come out of nowhere when analyzing the docked results in MD simulation.

We simulate 1IYT, in MD Simulation with 125 ns, to understand the simulation time and stability of the protein with respect to time in the simulation. The Initial Setup is 0.15M KCl, After running simulations, we calculated Backbone to Protein RMSD value, to identify the stability of Protein,

As we can see RMSD spikes after around 100 ns, and initially the Protein equilibrates pretty quickly, and largely stabilizes, albeit a small spike.

Protein largely stops conformation changes in the change, 50 ns and 100 ns, which indicates it largely stabilizes. We then proceed for initial simulation analysis for the Amyloid Beta with Aptamers we selected initially.

The initial Simulation conditions were set up as 0.15 M KCl, with the grid-box fully incorporating the Protein-Aptamer setup.

Important aspect was to determine the simulation time and condition for the setup, setting up the periodic boundary conditions.

Initially we ran the simulation for 10 ns each for both 1IYT and 5KK3, with the Protein Size, 4.28 kDA and 81.5 kDA respectively.

As expected, the Simulation wasn’t enough to establish any equilibration condition for the system, as the system contained high instability as indicated by the plots.

So, we reviewed Literature and analyzed experimental data for similar type of Protein-Systems, and found 0.15 M KCl + 0.15 M MgCl2 as high stable for the Protein-Aptamer based system,
For 1IYT, a smaller Protein, we will simulate it for 100 ns.
For 5KK3, a larger Protein, we will simulate it for 50 ns.

Now, for Aptamer T-SO508, we pick the cluster as discussed above in the docking part, which has the most stable structures.

The structures are highly unstable, as we can see four structures in there, with sudden spikes in RMSD. Equilibration of Protein-Aptamer doesn’t happen with stability, so we need to simulate it for longer than 100 ns.

Structure 4 is among all the structures is one of most stable structures, with RMSD value keeping low, and structure reaching nearly equilibration stage Rest of the structures have higher RMSD values and high spikes in the value.

Now, we analyze the Radius of Gyrations to see how Aptamers change in conformation, and check the stability of the Aptamer-Protein bond.

Here, we can clearly see Structure 4 has the least value of Radius of Gyration, and it further reaffirms the belief that Structure 4 is the most stable structure in this Cluster. We can further analyze it by running it at higher simulation time.

We can also check the RMSF value for checking the fluctuation of the aptamers, and it also turned out to be pretty low relative to the others.

Now, we compare Structure 4 with DNA Aptamer, MD Simulation result, we can see how both Aptamers behave, which gives us the indication of the better Aptamers for Wet Lab Analysis.

We can see after early equilibration, the DNA Aptamer can also give pretty good results in the Wet Lab experiments, even comparable to the best structure from other Aptamer Clusters.

Hence, we easily can suggest the best docking configurations with Aptamers we have taken initially using these above plots.

For 5KK3, The Fibril Form of AB-42, we have conducted Analysis for two structures each for the Two Aptamer Clusters found after docking analysis.

We do the analysis for the T-SO508 Aptamer and DNA Aptamer, at 50 ns .

Here, we can clearly see that one conformation of DNA Aptamer is completely out of the picture with high RMSD and higher deviations. We can compare the rest of the 3 structures.

Here we can see that DNA Aptamer 1st Structure has the lowest RMSD, and the deviations are pretty low, which means that it can effectively be used as an Aptamer for Amyloid Beta.

We can also check the Plots for radius of Gyration to see if conformation is changing quickly or not, and how high the value is, In the Graph we can see the radius of Gyration for DNA Aptamer 1st Structure is nearly constant, and its high, which further affirms we can use it as an Aptamer.

The RMS value of Aptamer also changes, which highlights potential sites of Mutation and important residues in the Protein.