Molecular Dynamics is an integral tool, can be employed in a variety of modern biological problems, case in point Drug Design, Wet-Lab Experiment Design. With the advent of the powerful “Computer” Era, especially the regularization of particularly notorious Supercomputers, Implementation of Molecular Dynamics Simulations in Biological situations has never been easier.

Even though the Time is ripe, the situation at-hand was quite dire. As we progressed through the project, We found the literature and direct material for implementation of Standard Molecular Dynamics Protocols, severely lacking. Even though the Documentation of Softwares like, GROMACS, AMBER, NAMD, have powerful documentation on their source site, For a Newbie getting started with Molecular Dynamics, It’s as helpful as reading a Binary .dat file. Furthermore, MD Simulation cannot be implemented directly, and needs a pipeline of Softwares to conduct Pre-Processing which is imperative for a successful MD run.

Nevertheless, we extensively conducted Literature reviews, and spent days browsing though the existing projects, and help develop a Standardized Molecular Dynamics Protocol for implementation of Protein - DNA Aptamer Simulation that includes sequential steps -

a) Pre-Docking Processing - Through Chimera, Xiao Lab, MFold
b) Docking - Using HADDOCK 2.0.4 WebServer for Protein - Nucleic Acid Docking
c) Pre - MD Processing
d) MD Input files generation - Using CHARMM-GUI web server
e) MD Simulation using - GROMACS

In our documentation, we have indicated all the aspects of the above mentioned steps which could be adapted to improve the MD Simulations of various different processes. We have provided the pathway for MD simulations which could be utilized by other teams readily for future projects and research projects.

Our struggles while in the Project-Phase prompted us to help share with the scientific community what we learned, and developed through our persistent attempts. We feel delighted we could help in any way possible.

We found an existing Aptamer part for Lactoferrin in the iGEM registry BBa_K3724005, gcaggacaccgtaacacgggcttttgctttatcgtaccctttatgctagattgtcctgc
For which we conducted experiments to characterize its behavior, using ITC and Electrochemical Sensing methods. We obtained various plots that helped us characterize its behavior. This would help future research projects based on Lactoferrin and its Aptamer for which are now complemented with data that was originally lacking. It would help both ongoing and future research projects.

The variations in each iteration of Electrochemical Sensing, and very intrinsic but a key aspect of designing Aptasensors. It is not a straightforward task in any way. In our engineering part, we had to iterate through many experiments to optimize our Electrodes, so that our results can be consistent. Aptasensors are extremely important in research these days, and through our protocols we established easier Optimization of Electrode Protocols.

Our project plays a crucial role in spreading awareness about Alzheimer's disease by offering an innovative and accessible diagnostic tool. By making Alzheimer's screening more convenient and user-friendly, we empower individuals to take charge of their cognitive health and consider early detection. This not only aids in timely intervention but also prompts conversations about Alzheimer's within families and communities, further breaking down the stigma associated with the disease. In providing an effective and easy-to-use tool for early diagnosis, our project actively contributes to raising awareness about Alzheimer's, fostering a better understanding of the disease, and ultimately promoting a proactive approach to managing this significant public health concern.