| IIT-Roorkee - iGEM 2023

Introduction

As not much Literature work has been done into the Simulation of Amyloid Beta Structures, 1IYT and 5KK3, we couldn’t guess initially the Simulation time and conditions for the Protein structures, so we conducted a series of experiments to finally understand the simulation parameters.

Cycle 1

Design

We obtained the 2-D and 3-D structures of Aptamer, and docked them with the respective proteins using HADDOCK, wherein we found the most energetically favorable Clusters on which we are planning to do MD simulations. We firstly run the simulations on Protein 1IYT, independently.

Build

We generate the input files for MD simulations of the 1IYT Protein, using CHARMM-GUI, where we set up the MD conditions with generated Grid Box, and 0.15 M KCl solution, and hence we obtain the GROMACS input files, in .mdp format, along with the Topology files.

Test

We initially set the simulation time to be 125 ns. We run the Energy Minimization Run, NVT, NPT and finally the Molecular Dynamics run, and hence we obtain the results, through which we create a MD movie, and finally run the commands for RMSD, RMSF, H-bond and Radius of Gyration Analysis.

Learn

After analyzing the results, We understood that Protein stabilizes in the region of 50 ns - 100 ns, after that protein undergoes spikes in its RMSD and Gyration radius, hence we could run our MD Simulation for the time of 100 ns in case of 1IYT which is small and 50 ns in case of 5KK3, which is large in shape.

Cycle 2

Design

After the previous Cycle, we learned the simulation time for the proteins. We pick the best clusters for the proteins, run the GROMACS simulations on it. We pick 50 ns and 100 ns for the docked structures.

Build

We set the simulation time 50 ns and 100 ns. We generate the input files for MD simulations of the 1IYT Protein, using CHARMM-GUI, where we set up the MD conditions with generated Grid Box, and 0.15 M KCl + + 0.15 M MgCl2 solution, and hence we obtain the GROMACS input files, in .mdp format, along with the Topology files.

Test

We set the simulation parameters and run the Energy Minimization Run, NVT, NPT and finally the Molecular Dynamics run, and hence we obtain the results, through which we create a MD movie, and finally run the commands for RMSD, RMSF, H-bond and Radius of Gyration Analysis.

Learn

As we can see the graphs above, the Simulation for few structures is yielding highly unstable data, at 100 ns simulation time, which indicates we need to study the simulation for a longer time, but we also learned the simulation condition 0.15 M KCl and MgCl2 is an ideal as we are able to significantly reduce the RMSD as compared to first cycle. We need more cycles to fully understand the stability of conformations that are showing thermodynamic stability at higher simulation time.

References

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6096388/

https://www.mdpi.com/1420-3049/21/4/421

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7689369/

https://www.frontiersin.org/articles/10.3389/fchem.2023.1144347/full

https://pubs.acs.org/doi/pdf/10.1021/ja9719586?src=getftr

https://www.sciencedirect.com/science/article/pii/S0039914011004978

Introduction

As we skimmed through the iGEM directory for the part for Lactoferrin Aptamer, for our efforts to make a better part, which shows better affinity for Lactoferrin, as lactoferrin is a protein that is used in multiple places throughout the world. For this, we wanted to do Mutations to the aptamer sequence which are in binding pockets with protein, and analyze the results.

Cycle 1

Design

We pick the Aptamer sequence, for Lactoferrin,
gcaggacaccgtaacacgggcttttgctttatcgtaccctttatgctagattgtcctgc
After analyzing the simulation data for this Aptamer, we make a few nucleotide substitutions and obtain new simulation data.

Build

We set the simulation time for 50 ns. For the Mutated Aptamer sequence, we obtain the 2-D and 3-D structure of the Aptamer, and then dock it with Lactoferrin structure using HADDOCK, then we generate the simulation parameter files using CHARMM-GUI, for running the GROMACS simulation.

Test

We initially set the simulation time to be 50 ns. We run the Energy Minimization Run, NVT, NPT and finally the Molecular Dynamics run, and hence we obtain the results, through which we create a MD movie, and finally run the commands for RMSD, RMSF, H-bond and Radius of Gyration Analysis.

Learn

We learned from the plots that even after Mutation, the RMSD and Gyration radius values don’t really change much, that means we have to make more directed mutations in this case, with specific targets in various pockets. For that we have to make more simulations and generate more data to improve the Aptamer part.

Introduction

The report to report variation in electrochemical sensing, the very nascent stage of aptasensor research and the several different fabrication strategies available makes measuring with Electrochemical Aptasensors a not so straightforward task. We had to iterate through multiple cycles to optimize our protocol design.

Cycle 1

Design

Based on our literature review, a preliminary protocol was designed based on using a Self-Assembly-Monolayer (SAM) of Mercaptohexanol (MCH) and Thiolated Aptamer to prevent aptamer fouling and block the remaining electrode[5].

Build

The Aptasensor Fabrication Protocol was followed and MCH was backfilled as a blocking agent after aptamer immobilization and incubation overnight. This was then washed with PBS and incubated again before electrochemical analysis was done. Sensing studies with analytes (Lactoferrin, 10μL of all concentrations) were also performed.

Test

Both CV and DPV were performed on fabricated electrodes and bare SPEs too. CV results didn’t show much variation, and we weren’t completely satisfied with the DPV results either as we thought we could optimize for a greater difference between the two currents. Some electrodes were giving unstable results as well. The current plots of the analyte sensing studies saturated after two concentrations.

Learn

We interpreted the results to indicate possible fouling and blocking of electrode sites by the aptamer. The unstable electrodes also probably indicated leaching of aptamers (See Notes in Wet Lab Results Section) due to re-oxidation of thiol groups. The saturation of Aptamers with Lactoferrin was possibly due to the volume of Lactoferrin we used being more than available aptamers for binding.

Cycle 2

Design

We tried optimizing the protocol for Analyte Sensing Studies by using lesser concentrations of Lactoferrin on each electrode.

Build

The same immobilization protocol was followed. Sensing studies were performed using 3μL Lactoferrin on each electrode instead of 10μL.

Test

Successful sensing studies were performed, with distinct DPV plots in the required range, before reaching saturation current (see Results page).

Learn

For successful detection of our biomarker we would have to either ensure more specific control and studies of sample quantity or optimize our immobilization protocol to have more available aptamers for binding. We were also still unsatisfied with the Aptasensor Fabrication from the first DBTL Cycle.

Cycle 1

Design

We decided to try a second immobilization protocol, this time co-immobilizing the initial DTT used to reduce the aptamer along with the aptamer. We had read about SAMs using DTT as well, proving to be more effective than MCH. [6]

Build

The same immobilization protocol was followed except DTT was co-immobilised with DNA:DTT ratio of 1:10. MCH was backfilled as a blocking agent after incubation overnight. This was then washed with PBS and incubated again before electrochemical analysis was done. This time, sensing studies were also performed subsequently.

Test

DPV was performed on the fabricated electrodes and bare SPEs. The DPV plots showed a significant increase in current (roughly 72μA). However, on performing analyte studies (with 3μL), it reached saturation current at 1μg/mL itself.

Learn

Even though much higher DNA:DTT ratios have been reported, the available aptamers for binding are clearly not sufficient for sensing. Perhaps our overall concentration of aptamer solutions must be optimized. It is possible that DTT was interfering with our sensing studies and not having the desired effect at all. We will continue to optimize these protocols until we can develop reproducible results.

References

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6096388/

https://www.mdpi.com/1420-3049/21/4/421

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7689369/

https://www.frontiersin.org/articles/10.3389/fchem.2023.1144347/full

https://pubs.acs.org/doi/pdf/10.1021/ja9719586?src=getftr

https://www.sciencedirect.com/science/article/pii/S0039914011004978