Protocol

• PCR amplification

Introduction

All of our PCR amplifications follow the instructions of PrimeSTAR® HS DNA Polymerase(Takara).

Reagents:

• ddH2O
• 5 × PrimeSTAR Buffer(Mg ²⁺ Plus)
• dNTP Mixture(2.5mM each)
• Primer 1
• Primer 2
• Template
• PrimeSTAR HS DNA Polymerase(2.5U/μl)

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• Gene amplifier
• Ice bucket filled with ice

Reaction System:

Reagent	Volume/Amount	Final Concentration
5 × PrimeSTAR Buffer(Mg2+ Plus)	10 μL	1x
dNTP Mixture(2.5mM each)	4 μL	200 μM each
Primer 1	10-15 pmol	0.2-0.3 μM
Primer 2	10-15 pmol	0.2-0.3 μM
Template	<200 ng	Plasmid DNA 10 pg-10 ng
PrimeSTAR HS DNA Polymerase(2.5U/μl)	0.5 μL	1.25 U/50 μL
ddH2O	Up to 50 μL	-

Procedure:

	Temperature	Time
Initial Denaturation	98℃	1min
Denaturation	98℃	10s
Annealing	55℃	5s	x35
Extension	72℃	1min/kb
Final Extension	72℃	2min
Hold	4℃	∞

Note: The process of adding reagents should be done on ice. Enzymes should be added last. The system should be vortexed to mix after configuration and centrifuged instantly before PCR amplification. Experimental conditions should be adjusted in detail according to the actual situation.

• Colony PCR

Introduction

All of our PCR amplifications follow the instructions of PrimeSTAR® HS DNA Polymerase(Takara).

Reagents:

• ddH2O
• 5 × PrimeSTAR Buffer (Mg2+ Plus)
• dNTP Mixture (2.5mM each)
• Primer 1
• Primer 2
• Template
• PrimeSTAR HS DNA Polymerase (2.5U/μl)

Equipment:

• Pipette & tips
• RNase-free microcentrifuge tubes
• Microcentrifuges
• Gene amplifier
• Ice bucket filled with ice

Reaction System:

Reagent	Volume/Amount	Final Concentration
5 × PrimeSTAR Buffer(Mg2+ Plus)	10 μL	1x
dNTP Mixture(2.5mM each)	4 μL	200 μM each
Primer 1	10-15 pmol	0.2-0.3 μM
Primer 2	10-15 pmol	0.2-0.3 μM
Template	<200 ng	Plasmid DNA 10 pg-10 ng
PrimeSTAR HS DNA Polymerase(2.5U/μl)	0.5 μL	1.25 U/50 μL
ddH2O	Up to 50 μL	-

Procedure:

	Temperature	Time
Initial Denaturation	98℃	1min
Denaturation	98℃	10s
Annealing	55℃	5s	x35
Extension	72℃	1min/kb
Final Extension	72℃	2min
Hold	4℃	∞

Note: The process of adding reagents should be done on ice. Enzymes should be added last. The system should be vortexed to mixed after configuration and centrifuged instantly before PCR amplification. A small portion of a single colony is gently picked with the tip of the gun, and then the colony-soaked tip is placed into the reaction solution and stirred a bit to allow the colony to enter the PCR system. DNA template is from the colony in this reaction. Experimental conditions should be adjusted in detail according to the actual situation.

• Golden Gate Assembly

Introduction

All of our assembly solutions use the Golden Gate assembly solution provided in SEVA 3.1, enabling interoperability of DNA assembly among the SEVA, BioBricks, and Type IIS restriction enzyme standards.

Reagents:

• BsaI HFv2 (NEB)
• T4 DNA ligase (NEB)
• 10x Buffer for T4 DNA ligase with 10mM ATP (NEB)
• DNA for assembly
• DpnI (NEB)
• BSA (20mg/ml)

Equipment:

• Pipette & tips
• RNase-free microcentrifuge tubes
• Microcentrifuges
• Gene amplifier
• Ice bucket filled with ice

Reaction System

(Ⅰ) Golden Gate Master Mix

Reagent	Volume
10x Buffer for T4 DNA ligase with 10mM ATP (NEB)	18 μL
BSA (20mg/ml)	1 μL
DpnI (NEB)	1 μL
T4 DNA ligase (NEB)	10 μL
BsaI HFv2 (NEB)	12 μL
Total	42 μL

(Ⅱ) Final Reaction System

Reagent	Volume	Final Concentration
Golden Gate Master Mix	2 μL	-
DNA for assembly	6 μL	The concentration of all DNA sequences to be assembled in the final system should be 1 nM

Procedure

	Temperature	Time
Initial Denaturation	37℃	20min
Ligase	16℃	4min	x30
Digest	37℃	20min	x30
	50℃	10min
Inactivation	80℃	10min
Hold	4℃	∞

Note: The process of adding reagents should be done on ice. Enzymes should be added last. The system should be vortexed to mixed after configuration and centrifuged instantly before PCR amplification.

• In vitro transcription

Introduction

The in vitro transcription protocol follows the instructions for the T7 High Yield RNA Synthesis Kit (Yeasen).

Reagents:

• Template DNA
• RNase-free H2O
• CTP (100mM each)
• GTP (100mM each)
• ATP (100mM each)
• UTP (100mM each)
• T7 RNA Polymerase Mix

Equipment:

• Pipette & tips
• RNase-free microcentrifuge tubes
• Microcentrifuges
• Thermo-Shaker
• Ice bucket filled with ice

Reaction System

Reagent	Volume/Amount	Final Concentration
CTP (100mM each)	2 μL	10 mM
GTP (100mM each)	2 μL	10 mM
ATP (100mM each)	2 μL	10 mM
UTP (100mM each)	2 μL	10 mM
10x Transcription Buffer	2 μL	1x
Template DNA	1 μg	-
T7 RNA Polymerase Mix	2 μL	-
RNase-free H2O	Up to 20 μL	-

Procedure

Mix the above reaction solution, briefly centrifuge to the bottom of the tube, and incubate at 37℃ for 4~8 hours.

Note:

• The circular plasmids have no effective termination, RNA products of different lengths will be transcribed. In order to obtain a specific length RNA, the plasmid must be completely linearized. The plasmid is recommended to be purified when used as a template for in vitro transcription after linearization.
• Centrifuge the T7 RNA Polymerase Mix briefly and place on ice. Thaw 10x Transcription Buffer and ribonucleotides (ATP, CTP, GTP, UTP), mix and centrifuge to the bottom of the tube, place 10x Transcription Buffer at room temperature, and place 4 types of ribonucleotides on ice.
• The reaction is configured at room temperature. Since 10x Transcription Buffer contains spermidine, the concentration of spermidine too high will cause DNA template precipitation at low temperature.
• Enzymes should be added last. Experimental conditions should be adjusted in detail according to the actual situation. The reagents and containers must be without RNase contamination.

• Gel electrophoresis(DNA)

Introduction

Gel electrophoresis is used to test whether PCR is successful or not.

Reagents:

• Agarose (BIOWESTE)
• GelStain (Transgen)
• 1x TAE Buffer
• DNA marker (Takara)
• DNA Samples (with loading buffer from TIANGEN)

Equipment:

• Pipette & tips
• RNase-free microcentrifuge tubes
• Microcentrifuges
• Electrophoresis
• Electrophoresis tank
• Ice bucket filled with ice
• Electronic scale
• Weigh paper
• Microwaves
• Conical flask
• Measuring tube

Procedure

Agarose Gel Configuration

Reagent	Volume/Amount	Final Concentration
Agarose	2 g	1%
1x TAE Buffer	200 mL	1

1. Use an electronic scale to weigh 1 g of agarose into a conical flask.
2. Measure 100 ml of 1x TAE Buffer into a conical flask and shake gently.
3. Put the conical flask with agarose into the microwave oven to heat up. During the period of time, pay attention to shake the conical flask in order to prevent the agarose paste bottom.
4. When the agarose is completely dissolved, take out the conical flask and place it at room temperature. Cool it until it is slightly hot and then pour the solution into the mold.
5. Immediately add GelStain to the agarose solution in the mold at a ratio of 1:10,000 and mix well.
6. Allow the prepared gel to solidify at room temperature (40 min ~ 50 min).

Electrophoresis

1. Add 6x loading buffer to the PCR product at a ratio of 1:6, vortex to mix thoroughly and then centrifuge instantaneously. Then DNA samples processed are obtained.
2. Add a sufficient amount of 1x TAE buffer to the electrophoresis tank (enough to cover the gel block).
3. Remove the solidified gel from the mold and put it into the electrophoresis tank with electrophoresis solution.
4. Add DNA samples to sample holes.
5. Cover the electrophoresis tank and place an ice box to prevent the electrophoresis solution from overheating.
6. Turn on the electrophoresis instrument, set the voltage 135V, time 35 min.
7. After electrophoresis is completed, the gel is taken out and placed into a gel image system for development.

Note:

Gel volume can be increased or decreased according to actual needs. More buffer can be added when configuring the gel solution to offset heat evaporation losses.

• Gel electrophoresis(RNA)

Introduction

We use the NorthernMax™ Kit (Thermo Fisher) to do this experiment.

Reagents:

• Agarose (BIOWESTE)
• 10,000X SYBR Gold Nucleic Acid Gel Dye
• 1x MOPS Buffer
• RNA marker
• RNA Samples
• Formaldehyde Load Dye
• Formaldehyde
• RNase-free water
• RNaseZap
• DMSO

Equipment:

• Pipette & tips
• RNase-free microcentrifuge tubes
• Microcentrifuges
• Electrophoresis
• Electrophoresis tank
• Ice bucket filled with ice
• Electronic scale
• Weigh paper
• Microwave oven
• Conical flask
• Measuring tube
• Comb
• Mold

Procedure

Agarose Gel Configuration

Reagent	Volume/Amount	Final Concentration
Agarose	1 g	1%
1x MOPS Buffer	82 mL
Formaldehyde	18 mL

1. Use RNaseZap to spray-wash various instruments required for electrophoresis, including electrophoresis tanks, conical flasks, gel plates, sample combs, measuring cylinders, etc. Then wash off the foam with RNase-free water.
2. Use an electronic scale to weigh 1 g of agarose into a conical flask.
3. Measure 82 ml of 1x MOPS Buffer into a conical flask and shake it gently.
4. Put the conical flask with the medicines into the microwave oven to heat up. During the period of time, pay attention to shake the conical flask in order to prevent the agarose paste bottom.
5. When the agarose is completely dissolved, take out the conical flask and place it at room temperature. Cool it until it is slightly hot and then add 18 mL formaldehyde to it.
6. Pour the solution into the mold.
7. Immediately add 10,000X SYBR Gold Nucleic Acid Gel Dye to the agarose solution in the mold at a ratio of 1:10,000 and mix well.
8. Allow the prepared gel to solidify at room temperature (40 min ~ 50 min).

Electrophoresis

1. Add three times the volume of Formaldehyde Load Dye and one tenth of the volume of 10X SYBR Gold Nucleic Acid Gel Dye (diluted in DMSO, 1 ml of DMSO with 1 μl of 10,000X SYBR Gold Nucleic Acid Gel Dye) to the RNA. Incubate it for 15 min at 65°C to denature the RNA and leave it on ice.
2. Add a sufficient amount of 1x MOPS buffer to the electrophoresis tank (enough to cover the gel block).
3. Remove the solidified gel from the mold and put it into the electrophoresis tank with electrophoresis solution.
4. Add RNA samples.
5. Cover the electrophoresis tank and place some ice boxes to prevent the electrophoresis solution from overheating.
6. Turn on the electrophoresis instrument, set the voltage 110V, time 45 min.
7. After electrophoresis is completed, the gel is removed and placed into a gel image system for development.

Note:

Gel volume can be increased or decreased according to actual needs. More buffer can be added when configuring the gel solution to offset heat evaporation losses.

• Small volume extraction of plasmids

Introduction

We follow the instructions for the TIANprep Rapid Mini Plasmid Kit (TIANGEN).

Reagents:

• TIANRed
• Buffer P1 (PN)
• Buffer P2 (P2)
• Buffer P4 (P4)
• Buffer PWT (PWT)
• Buffer TB (TB)
• RNase A (100 mg/ml)
• Anhydrous ethanol
• Bacterium solution to be lysed

Equipment:

• Pipette & tips
• Centrifuge tubes
• Microcentrifuges
• Vortex meter
• Microspectrophotometer
• Spin Columns CP3
• High-speed centrifuge
• Collection Tubes
• Ice bucket filled with ice

Procedure

1. Add RNase A and TIANRed to P1. Add anhydrous ethanol to PW.
2. Take 1-4 ml of bacterium cultured overnight to a centrifuge tube and centrifuge it for 1 min at 12,000 rpm using a conventional tabletop centrifuge. Aspirate off as much of the supernatant as possible.
3. Add 150 μl of P1 to the centrifuge tube that retains the bacterial precipitate and vortex it thoroughly until the bacterial precipitate is completely suspended.
4. Add 150 μl of P2 to the centrifuge tube and gently turn the tube up and down 6-8 times to fully lyse the bacteria.
5. Add 350 μl of P5 to the centrifuge tube and immediately turn it up and down 12-20 times to mix it quickly and thoroughly. Flocculent precipitate will appear at this time. Centrifuge the tube at 12,000 rpm for 2 min.
6. Place the Spin Columns CP3 into the collection tubes. Transfer the supernatant collected in the previous step to the Spin Columns CP3 with a pipette. Try not to aspirate the precipitate. Centrifuge it at 12,000 rpm for 30 s. Pour off the waste liquid in the collection tubes and put Spin Columns CP3 back into the collection tubes.
7. Take 100 ml bacterium solution from the overnight culture and add it to the centrifuge tube, centrifuge at 8000 rpm for 3 min at room temperature to collect the bacteria, and aspirate the supernatant as much as possible.
8. Add 300 μl of PWT to Spin Columns CP3. Centrifuge it at 12,000 rpm for 30 s, and pour off the waste liquid in the collection tube. Place Spin Columns CP3 back into the collection tubes.
9. To ensure that all of the supernatant is aspirated, use clean blotting paper to remove any water droplets from the walls of the bottle.
10. Centrifuge the empty Spin Columns CP3 at 12,000 rpm for 1 min to remove residual PWT.
11. Place the Spin Columns CP3 in a clean centrifuge tube, add TB dropwise to the center of the membrane. Centrifuge it at 12,000 rpm for 30 s to collect the plasmid solution.

Note:

Experimental conditions should be adjusted in detail according to the actual situation. The amount of plasmid extracted is related to the bacterial culture concentration, plasmid copy number, and other factors. The adsorption and elution time can be extended appropriately to improve the extraction efficiency.

• Plasmid Bulk Extraction

Introduction

We follow the instructions for the EndoFree Maxi Plasmid Kit (TIANGEN).

Reagents:

• Buffer BL (BL)
• Buffer P1 (P1)
• Buffer P2 (P2)
• Buffer P4 (P4)
• Buffer PW (PW)
• Buffer TB (TB)
• RNase A (100 mg/ml)
• Anhydrous ethanol
• Bacterium solution to be lysed

Equipment:

• Pipette & tips
• RNase-free microcentrifuge tubes
• Microcentrifuges
• Vortex meter
• Microspectrophotometer
• High-speed centrifuge
• Ice bucket filled with ice
• Filtration CS1
• Spin Columns CP6
• Collection Tubes

Procedure

1. Add RNase A to P1. Add anhydrous ethanol to PW.
2. Place the Spin Columns CP6 into the collection tubes, add 2.5 ml of BL to the Spin Columns CP6, centrifuge at 8,000 rpm for 2 min, pour off the waste liquid in the collection tubes, and put the Spin Columns back into the collection tubes.
3. Take 100 ml bacterium solution from the overnight culture and add it to the centrifuge tube, centrifuge at 8000 rpm for 3 min at room temperature to collect the bacteria, and aspirate the supernatant as much as possible.
4. To ensure that all of the supernatant is aspirated, use clean blotting paper to remove any water droplets from the walls of the bottle.
5. Add 8 ml of P1 to the centrifuge tube retaining the bacterial precipitate and vortex to thoroughly suspend the bacterial cell precipitate.
6. Add 8 ml of P2 to the centrifuge tube and immediately turn it up and down gently 6-8 times to fully lyse the organisms and leave it at room temperature for 5 min. At this point the bacterium solution should become clear and sticky.
7. Add 8 ml of P4 to the centrifuge tube, and immediately turn it up and down gently for 6-8 times, and mix it well until white dispersed flocculent precipitate appears. Then leave it at room temperature for about 10 min. Centrifuge at 8000 rpm for 5-10 min, so that the white precipitate leaves the bottom of the tube. Pour all the solution carefully into the filtration CS1, slowly push the handle to filtration, the filtrate is collected in a clean 50 ml tube.
8. Add 0.3 times the filtrate volume of isopropanol to the filtrate. Mix it upside down and transfer it to Spin Columns CP6, which was placed in a 50 ml collection tube.
9. Centrifuge at 8000 rpm for 2 min at room temperature, pour off the waste liquid in the collection tube, and put Spin Columns CP6 back into the collection tube. The solution obtained in step 8 should be passed through the column in two times.
10. Add 10 ml of PW to the Spin Columns CP6. Centrifuge it at 8000 rpm for 2 min, discard the waste liquid in the collection tube, and put the Spin Columns CP6 back into the collection tube.
11. Repeat step 10.
12. Add 3 ml of anhydrous ethanol to the Spin Columns CP6. Centrifuge it at 8000 rpm for 2 min at room temperature and pour off the waste liquid.
13. The Spin Columns CP6 is placed in a clean 50 ml collection tube and 1-2 ml of TB is added dropwise to the middle part of the adsorbent membrane and left at room temperature for 5 min. Then centrifuged it at room temperature at 8,000 rpm for 2 min. The eluent in the 50 ml centrifugation tube was transferred to a clean 1.5 ml centrifugation tube. Store at -20°C.

Note:

Experimental conditions should be adjusted in detail according to the actual situation. The amount of plasmid extracted is related to the bacterial culture concentration, plasmid copy number, and other factors. If the extracted plasmid is a low-copy plasmid or a large plasmid larger than 10 kb, the amount of bacteriophage used should be increased, and the amount of P1, P2, and P4 should be increased proportionally; the elution buffer is recommended to be preheated in a 65-70°C water bath. The adsorption and elution time can be extended appropriately to improve the extraction efficiency.

• Recovery of DNA from agarose gels

Introduction

We follow the instructions for the TIANgel Midi Purification Kit (TIANGEN).

Reagents:

• Buffer BL (BL)
• Buffer PN (PN)
• Buffer PW (PW)
• Ethanol
• ddH2O
• Gel block containing DNA

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes (EP tubes)
• Microcentrifuges
• Thermo-Shaker
• Electronic Scale
• Microspectrophotometer
• Spin Columns CA2
• High-speed centrifuge
• Collection Tubes
• Ice bucket filled with ice

Procedure

Preparation

1. Place the Spin Columns CA2 into the collection tubes, add 500 μL of BL to the Spin Columns CA2, centrifuge at 12,000 rpm for 1 min, pour off the waste liquid in the collection tubes, and put the Spin Columns CA2 back into the collection tubes.
2. Take several EP tubes and use an electronic scale to weigh the mass of each empty EP tube (m1).
3. Put the gel block containing the target DNA into a clean EP tube, weigh the mass (m2) in the EP tube after each loaded with gel block, mgel = m2 - m1.
4. Add an equal volume of PN to the gel block and leave it in a metal bath at 50°C, during which time the tube should be constantly and gently turned up and down to ensure that the gel block is fully dissolved. If there is still undissolved gel, continue to leave it for a few minutes or add some more PN until the gel is completely dissolved (if the volume of the gel is too large, the gel can be cut into pieces beforehand).
5. Add anhydrous ethanol to the PW, referring to the label on the bottle for the volume added.

Recovery

1. Add the dissolved colloid solution into the Spin Columns CA2 (the Spin Columns CA2 is put into the collection tube), leave it at room temperature for 2 min, centrifuge it at 12,000 rpm for 1 min, and pour out the waste liquid in the collection tube.
2. Add 600 μl of PW to the Spin Columns CA2, let it stand at room temperature for 5 min, centrifuge it at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube and put the Spin Columns CA2 into the collection tube.
3. Repeat step 2.
4. Place the Spin Columns CA2 back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove as much PW as possible. Leave the columns at room temperature for a few minutes and dry thoroughly to prevent the residual PW from affecting the next step of the experiment.
5. Place the Spin Columns CA2 in a clean centrifuge tube, add ddH2O dropwise to the center of the membrane, and leave it at room temperature for 2 min. centrifuge at 12,000 rpm for 2 min to collect the DNA solution.

Note:

All centrifugation steps were performed at room temperature using a bench-top centrifuge. Experimental conditions should be adjusted in detail according to the actual situation. If the gel weighs 0.1g, its volume can be considered as 100 μl, so 100 μl of PN should be added.

• RNA purification

Introduction

We follow the instructions for the RNAclean Kit (Tiangen).

Reagents:

• Buffer RK (RK)
• Buffer RW (RW)
• Ethanol
• β-mercaptoethanol
• ddH2O
• Sample

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• RNase free Centrifuge tubes
• High-speed centrifuge
• RNase-Free Collection Tubes
• Ice bucket filled with ice
• RNase-Free Columns CR2

Procedure

1. Add ddH2O to the RNA sample to make up to 100 μl. Then add 350 μl of RK to it and mix well.
2. Add 250ul of ethanol to it. Mix well.
3. The solution obtained in the previous step was transferred together with the precipitate into RNase-Free Columns CR2. After centrifugation at 12,000 rpm for 30 sec, the waste solution in the collection tube was discarded.
4. Add 500ul of RW to the RNase-Free Columns CR2. Leave it at room temperature for 2 min. then centrifuge it at 12000rpm for 30 sec, discard the waste liquid in the collection tube, and put RNase-Free Columns CR2 back into the collection tube.
5. Repeat step 4.
6. Centrifuge it at 12000rpm for 5 min and discard the waste liquid.
7. Put the RNase-Free Columns CR2 into a new RNase-Free centrifuge tube. Add 14-20 μl of ddH2O to it, leave it at room temperature for 2 min and then centrifuge it at 12000rpm for 2 min.

Note:

Add ethanol to buffer RW in advance. Add β-mercaptoethanol to RK to a final concentration of 1% before first use. Experimental conditions should be adjusted in detail according to the actual situation.

• Protein purification

Introduction

We follow the instructions for the His-tag Protein Purification Kit, His-Tag Protein Purification Kit with IDA-Ni Magnetic Agarose Beads, and SUMO Protease (Beyotime).

Reagents:

His-tag Protein Purification Kit

• BeyoGold™ His-tag Purification Resin (Reductant&Chelator-resistant)
• Native Lysis Buffer
• Native Wash Buffer
• Native Elution Buffer
• Lysozyme
• Empty Affinity Chromatography Column (3ml)

SUMO Protease

• SUMO Protease (10U/µl)
• 10X SUMO Protease Buffer + Salt
• 10X SUMO Protease Buffer – Salt

His-Tag Protein Purification Kit with IDA-Ni Magnetic Agarose Beads

• BeyoMag™ IDA-Ni Magnetic Agarose Beads for His-Tag Protein Purification
• Native Lysis Buffer
• Native Wash Buffer
• Native Elution Buffer

Equipment:

• Pipette & tips
• Low-temperature high-speed centrifuge
• High-speed centrifuge
• Vorteximeter
• Magnetic rack
• Ice bucket filled with ice
• Microcentrifuge tubes
• Microcentrifuges
• Thermo-Shaker
• Centrifuge tube

Procedure

Stage 1

1. Harvest 1ml bacteria by centrifugation at 4000g for 20 minutes at 4℃, or 15,000g for 1 minute. Discard supernatant. Proceed to bacteria lysis immediately.
2. Add 100 μl of lysis buffer to the bacteria pellet obtained per ml of LB culture. Resuspend the pellet completely by pipetting or vortex gently (avoid bubbles).
3. Add lysozyme to bacteria suspension at a final concentration of 1mg/ml, mix gently, and incubate on ice for 30 minutes.
4. Gently vortex several times during the incubation to ensure sufficient lysis of bacteria, avoiding bubble production.
5. Centrifuge at 15000g for 10 minutes at 4℃, take 10μl of supernatant for SDS-PAGE analysis, and collect the rest into another new centrifuge tube for protein purification.
6. Add 20μl BeyoGold™ His-tag Purification Resin (resuspend evenly prior to use) into the supernatant of lysate, and incubate for 30 minutes at 4℃ with agitation on a shaker to ensure a sufficient binding between His-tagged proteins and the resin.
7. Pellet the resin by centrifugation at 1000g for 10 seconds at 4℃, take 20μl of supernatant for SDS-PAGE analysis and discard the rest.
8. Resuspend resin with 40μl of wash buffer by pipetting gently, and centrifuge at 1000g for 10 seconds at 4℃. Take 20μl of supernatant for SDS-PAGE analysis and discard the rest.
9. Repeat step 8 once.
10. Add 20μl of elution buffer and resuspend the resin by pipetting gently. Centrifuge at 1000g for 10 seconds at 4℃, and then collect the supernatant that contains the purified His-tagged protein.
11. To increase protein recovery, step 10 can be repeated twice and a total 60μl of purified protein can be obtained.

Stage 2

Reagent	Volume/Amount
10X Reaction Buffer –/+ Salt	20 μL
SUMO-tag Protein (20μg)	Y μL
SUMO Protease (10U/μl)	1μL
H2O	Up to 200 μl

Enzymatic digestion at 25℃ for 1.5h

Stage 3

1. Resuspend the IDA-Ni beads by gently blowing with a pipette. Use 1 ml of magnetic bead suspension for every 5-10 mg of target protein (molecular weight of 60 kD).
2. Take an appropriate amount of IDA-Ni beads into a clean centrifuge tube, and remove the supernatant by magnetic separation; add an equal volume of Binding/Washing Buffer as that of the original magnetic bead suspension, or an appropriately large volume of Binding/Washing Buffer.
3. Wash the beads with Binding/Wash Buffer.
4. Resuspend IDA-Ni magnetic beads by gently blowing with a pipette. Place on a magnetic rack and separate for 10 seconds to remove the supernatant. Repeat the above steps twice.
5. Add IDA-Ni magnetic beads at the ratio of 1 ml of magnetic bead suspension for every 5-10 mg of target protein (molecular weight of about 60 kD) (usually about 10 ml, the amount of specific protein samples is related to the expression level of target proteins).
6. Place it on a side-swinging shaker or a rotary mixer, and incubate it at room temperature for 20-30 minutes.
7. After incubation, place it on a magnetic rack to separate for 10 seconds and aspirate the supernatant. The supernatant contains purified protein.

Note:

Experimental conditions should be adjusted in detail according to the actual situation.

• Protein expression

Reagents:

• Competent cell
• IPTG
• Antibiotics
• LB medium
• LB agar plate
• Plasmid
• PBS

Equipment:

• Pipette & tips
• Microcentrifuge tubes
• Microcentrifuges
• Thermo-Shaker
• Spectrophotometer
• Ultrasonic crusher
• High-speed centrifuge
• Ice bucket filled with ice
• Incubator
• Water bath

Procedure

1. Thaw one bottle of competent cells on ice for 30 minutes, then add 50ng plasmid to it and incubate it on ice for 5 minutes.
2. Place it in a 42°C water bath for 45 seconds and then leave it on ice for 2 minutes.
3. Add 5 mL LB medium and 800 μL of bacteria to 15 mL tubes, and culture on a shaker for 4 hours until the bacterial culture becomes cloudy.
4. Transfer them into 1L flasks, and supplement with 250mL of medium and 100 μL of CmR solution (50mg/mL), and incubate with shaking at 220rpm for 8 hours. Collect 1 mL of bacterial solution for later use.
5. Subsequently, add 200 μL of 0.5M IPTG to each vial to induce protein expression and incubate overnight at 28°C.
6. Collect the bacterial solution. Centrifuge at 12000r/min for 2 minutes and discard the supernatant. Analyze the cell lysate from bacteria before and after IPTG induction by SDS-PAGE gel electrophoresis.
7. Resuspend the cell precipitate with 30mL PBS.
8. Set the program of the ultrasonic crusher: power 100W, ultrasonic 3s, interval 3s, running a total of 10 minutes on the resuspension of bacterial liquid for cell crushing processing.
9. Centrifuge the sufficiently fragmented bacterial solution at 4°C for 10 minutes at 120000 r/min. After centrifugation, store the supernatant and precipitate separately.

Note:

Experimental conditions should be adjusted in detail according to the actual situation.

• SDS PAGE

Reagents:

• Protein solution
• Reverse osmosis H2O (RO H2O)
• Sodium dodecyl sulfate (SDS)
• 30% Acrylamide mixture
• 1.0M Tris-HCl (pH=6.8)
• 1.5M Tris-HCl (pH=8.8)
• SDS PAGE loading buffer
• 10% Ammonium persulfate solution
• TEMED
• 1x SDS-PAGE electrophoresis solution
• Isopropanol

Equipment:

• Pipette & tips
• Centrifuge tubes
• Microcentrifuges
• High-speed centrifuge
• Ice bucket filled with ice
• Electrophoresis tank
• Electrophoresis
• Shaker
• Comb

Reaction system

10% Separator glue

Reagent	Volume/Amount
RO H2O	4 ml
30% Acrylamide mixture	3.1 ml
1.5M Tris-HCl	2.5 ml
10% SDS	0.1 ml
10% Ammonium persulfate solution	0.1 ml
TEMED	0.004 ml
Total	10 ml

5% Concentrated gel

Reagent	Volume/Amount
RO H2O	1.4 ml
30% Acrylamide mixture	0.33 ml
1.0M Tris-HCl	0.25 ml
10% SDS	0.02 ml
10% Ammonium persulfate solution	0.02 ml
TEMED	0.002 ml
Total	2 ml

Procedure

1. Add 2x SDS PAGE loading Buffer to each tube containing the collected samples. Boil it for 5 minutes and then ice bath it for 2 minutes. Centrifuge it at 12000rpm for 10 minutes, and store the supernatant at -20℃.
2. Choose a 10% acrylamide gel for the experiments.
3. Assemble the gel rack. Prepare 10 ml of 10% separator glue, add TEMED at the end and blow quickly to mix well to prevent solidification. Punch the glue into the clamped plate and add 1 ml of isopropanol to the plate to eliminate air bubbles. Let it solidify for 30 minutes and then discard the isopropanol. Prepare another 2 ml of 5% concentrated gel, mix well and add it to the plate, slowly insert the comb, and place it on a flat table for 30 minutes.
4. After the concentrated gel solidifies at room temperature, gently pull out the comb. Add 5 ml of protein marker and 10 ul of prepared protein sample. Place the prepared gel into the electrophoresis tank. Add 1x SDS-PAGE electrophoresis solution to the electrophoresis tank. Set the voltage to 90V for 30 minutes. When the sample enters the concentrated gel, switch the voltage to 120V for 90 minutes.
5. At the end of electrophoresis, remove the separator glue, put it into the Thomas Brilliant Blue staining solution, bleach and stain on a horizontal shaking table for more than 8 hours, and then decolorize with decolorizing solution. Change the decolorizing solution every 1 hour until decolorization is complete. Observe it with a protein gel imaging system.

Note:

Experimental conditions should be adjusted in detail according to the actual situation.

• Western Blot

Reagents:

• Protein solution
• Reverse osmosis H2O (RO H2O)
• Sodium dodecyl sulfate (SDS)
• 30% Acrylamide mixture
• 1.0M Tris-HCl (pH=6.8)
• 1.5M Tris-HCl (pH=8.8)
• SDS PAGE loading buffer
• 10% Ammonium persulfate solution
• TEMED
• 1x SDS-PAGE electrophoresis solution
• Isopropanol
• Primary antibody specific to target protein
• Secondary antibody conjugated with an enzyme or fluorophore
• Tris Buffered Saline with Tween
• Non-fat milk

Equipment:

• Pipette & tips
• Microcentrifuge tubes
• Microcentrifuges
• High-speed centrifuge
• Ice bucket filled with ice
• Electrophoresis tank
• Electrophoresis
• Shaker
• Comb
• Sponge
• Filter paper

Reaction system

10% Separator glue

Reagent	Volume/Amount
RO H2O	4 ml
30% Acrylamide mixture	3.1 ml
1.5M Tris-HCl	2.5 ml
10% SDS	0.1 ml
10% Ammonium persulfate solution	0.1 ml
TEMED	0.004 ml
Total	10 ml

5% Concentrated gel

Reagent	Volume/Amount
RO H2O	1.4 ml
30% Acrylamide mixture	0.33 ml
1.0M Tris-HCl	0.25 ml
10% SDS	0.02 ml
10% Ammonium persulfate solution	0.02 ml
TEMED	0.002 ml
Total	2 ml

Block buffer

Reagent	Volume/Amount
Non-fat milk	2.5 g
TBST	50 ml

Procedure

1. Add 2x SDS PAGE loading Buffer to each tube containing the collected samples. Boil it for 5min and then ice bath it for 2min. Centrifuge it at 12000rpm for 10min, and store the supernatant at -20℃.
2. 10% acrylamide gel was chosen for the experiments
3. Assemble the glue rack. Prepare 10 ml of 10% separator glue, add TEMED at the end and blow quickly to mix well to prevent solidification. Punch the glue into the clamped plate and add 1ml of isopropanol to the plate to eliminate air bubbles. It was placed on a flat bench top and allowed to solidify for 30 min and then the isopropanol was discarded. Prepare another 2ml of 5% concentrated gel, mix well and add it to the plate, slowly insert the comb and place it on a flat table for 30min.
4. After the concentrated gel solidified at room temperature, gently pull out the comb. Add 5ml of protein marker and 10 μl of prepared protein sample. Place the prepared gel into the electrophoresis tank. Add 1x SDS-PAGE electrophoresis solution to the electrophoresis tank. Set the voltage to 90V for 30min. When the sample enters the concentrated gel, switch the voltage to 120V for 90min.
5. Take out the separation gel. Incubate it in methanol.
6. Assemble the "sandwich" in the form of one layer of sponge - two layers of filter paper - separation gel - PVDF membrane - two layers of filter paper - one layer of sponge. Insert the "sandwich" into the electrophoresis tank.
7. Add 1x Trans buffer to electrophoresis tank. Electrophoresis it at 200mA for 2h.
8. Take out the PVDF membrane after electrophoresis. Block the PVDF membrane by incubating it in block buffer for 30min at room temperature.
9. Incubate the membrane with the primary antibody diluted in blocking buffer, following the recommended antibody concentration and incubation time.
10. Wash the membrane several times with TBST to remove unbound primary antibody. Wash five times for 5 minutes at a time.
11. Incubate the membrane with the secondary antibody conjugated with an enzyme or fluorophore at room temperature for 1h.
12. Repeat step 8
13. Observe it with an imaging system.

Note:

Experimental conditions should be adjusted in detail according to the actual situation. Secondary antibody we used is HRP. Sponge and filter paper need to be soaked for 30min in advance.

• Transformation for competent cell

Introduction

All of our PCR amplifications follow the instructions of Trans1-T1 Phage Resistant Chemically Competent Cell (Transgen).

Reagents:

• Trans1-T1 Phage Resistant Chemically Competent Cell
• Plasmids to be transformed
• LB medium (without antibiotics)
• LB Agar plates
• Antibiotics

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Waterbath
• Incubator
• Thermostatic Oscillation Incubator
• Ice bucket filled with ice

Reaction system

Reagent	Volume/Amount
Trans1-T1 Phage Resistant Chemically Competent Cell	40 μL
Plasmids to be transformed	X ng

Procedure

1. Take 40 μL of Trans1-T1 melted on the ice bath. Add target DNA and mix gently.
2. Place it in an ice bath for 30 minutes.
3. Cells were incubated at 42℃ for 30 seconds, followed by a rapid ice bath for 2 minutes.
4. Add 500 μL of sterile LB medium (without antibiotics). Mix well and incubate it at 37℃, 200rpm for 1 hour to revive the bacteria.
5. According to the experimental requirements, aspirate different volumes of transformed competent cells and add them to LB agar medium containing corresponding antibiotics, spread the cells evenly. Place the plate at 37℃ until the liquid is absorbed, invert the plate and incubate at 37℃ overnight.

Note:

The process of adding reagents should be done on ice. Experimental conditions should be adjusted in detail according to the actual situation.

• Restriction enzyme digestion

Introduction

Restriction enzyme digestion is used to verify the success of PCR amplification.

Reagents:

• ddH2O
• Enzyme
• Cut Buffer
• DNA

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• Thermo-Shaker
• Ice bucket filled with ice

Reaction system

Reagent
Cut Buffer	Follow the instructions for the enzyme
Enzyme
DNA
ddH2O

Note:

The process of adding reagents should be done on ice. Enzymes should be added last. Experimental conditions should be adjusted in detail according to the actual situation.

• LB medium configuration

Reagents:

• Yeast Extract
• Tryptone
• NaCl
• NaOH
• H2O

Equipment:

• Pipette & tips
• Centrifuge tubes
• Autoclave
• Electronic Scale
• Weigh paper

Procedure:

Reagent	Volume/Amount
Yeast Extract	5g
Tryptone	10g
NaCl	10g
NaOH	Until pH=7.0
H2O	Up to 1 L

Autoclave for 20 minutes after mixing.

• LB solid medium

Reagents:

• Yeast Extract
• Tryptone
• NaCl
• NaOH
• Agar powder
• Antibiotics
• H2O

Equipment:

• Pipette & tips
• Centrifuge tubes
• Autoclave
• Electronic Scale
• Weigh paper

Procedure:

Reagent	Volume/Amount
Yeast Extract	5g
Tryptone	10g
NaCl	10g
Agar powder	1.5g
NaOH	Until pH=7.0
H2O	Up to 1 L

Autoclave for 20 minutes after mixing. Add antibiotics when the temperature drops to 55°C.

• TB medium configuration

Reagents:

• Yeast Extract
• Tryptone
• K₂HPO₄
• KH₂PO₄
• Glycerol (80%)
• Antibiotics
• H₂O

Equipment:

• Pipette & tips
• Centrifuge tubes
• Autoclave
• Electronic Scale
• Weigh paper

Procedure:

Reagent	Volume/Amount
Yeast Extract	23.6 g	Solution 1 (with 900ml H2O)
Tryptone	11.8 g
Glycerol (80%)	4 ml
K2HPO4	9.4 g	Solution 2 (with 100ml H2O)
KH2PO4	2.29 g
Total	1 L

After preparing solutions 1 and 2, autoclave them. When solution 1 is cooled to below 60°C, pour in solution 2. Add antibiotics to the medium after cooling.

• SOC medium configuration

Reagents:

Reagent	Volume/Amount
Yeast Extract	5g
Tryptone	20 g	SOB
NaCl	0.5 g
KCl(250mmol/L)	10 mL
MgCl2(2mol/L)	5 mL
Glucose(1mol/L)	20 mL
Total	1 L

Procedure:

SOB was prepared first. Autoclaved and cooled it to below 60°C. Then add glucose (decontaminated) to it.

• 50× TAE solution

Introduction

50× TAE solution was diluted to obtain 1× TAE solution for gel electrophoresis.

Reagents:

• Reverse osmosis H2O
• Glacial acetic acid
• Na2EDTA•2H2O
• Tris (hydroxymethyl)aminomethane(Tris) - 242 g

Equipment:

• Pipette & tips
• Reagent bottles
• Electronic Scale
• Weigh paper
• Glass rod
• Volumetric cylinder

Reaction system

Reagent	Volume/Amount
Tris (hydroxymethyl)aminomethane(Tris)	242 g
Na2EDTA•2H2O	37.2 g
Glacial acetic acid	57.1 ml
Reverse osmosis H2O	Up to 1L

Mix the above reagents.

• Cell transfection

Reagents:

• OPti-Medium
• RNA iMax
• Cells
• Mimic-21-5p
• DEPC H2O
• DMEM(- -)

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• Thermostatic incubator

Procedure

Solution 1

Reagent	Volume/Amount
OPti-Medium	950 μl
RNA iMax	5 μl
Mimic-21-5p	5 μl

*Wait 5min after mixing OPti-Medium and RNA iMAX. Then add mimic-21-5p to it and wait for 20min.

Solution 2

Reagent	Volume/Amount
Cells	8*10^5
DMEM(- -)	100 μl

Add 100μl of solution 1 to solution 2.

Note: Experimental conditions should be adjusted in detail according to the actual situation. Mimic-21-5p is consist of 1OD powder dissolved with 125 μl DEPC H2O.

• Invasion assay

Introduction

We performed an invasion assay to verify that miR-21-5p has a role in promoting breast cancer cell invasion.

Reagents:

• Serum-free medium
• PBS
• Medium with 20% serum
• DMEM
• Matrigel
• ddH2O
• 1% Giemsa stain
• 4% paraformaldehyde
• Cells

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• Microscope
• Thermostatic incubator
• High-speed centrifuge
• 24-transwell (Corning) (8μm)

Procedure

Day 1

1. Add 40 μl of prepared Matrigel to the Transwell (prepared Matrigel: Matrigel: empty medium DMEM = 1:3~1:5). Leave it at 37°C until Matrigel solidifies.
2. Take out the cultured cells, discard the medium, digest the cells with trypsin. After termination of the medium containing serum, collect the cells in a 15ml centrifuge cylinder and centrifuge it at 1000rpm for 5min.
3. Discard the supernatant, gently resuspend the cells with 5 ml of PBS/serum-free medium for washing, and centrifuge it at 1000 rpm for 5min.
4. Resuspend the cells with 2 ml of serum-free medium for cell counting. (how many cells put in each well is determined by the size of the cells, how fast they grow, and whether they are easy to invade). The number of cells is usually 3~8×104. The volume of cells and serum-free medium is 100 μl in total.
5. In the empty 24-well plate, add 600 μl of culture medium with 20% serum at the bottom of each well. Sit the chamber on the top and add 200 μl of mixed serum-free cell mixture into the upper chamber (the cells should be mixed before adding). Add the cells vertically. Be careful not to touch the upper surface of the chamber. Culture it at 37℃ for 48h. (According to the different cell culture time is different, generally 16h-18h/24h).

After 48h

1. Try to suck the medium from the upper and lower chambers as much as possible. When sucking the medium from the underneath of the upper chamber, do not touch the center, but only suck from the edge.
2. Add 850 μl of PBS to the empty wells. Immerse the lower surface of the chamber in PBS for 3 s. Pick up the small chamber and gently aspirate the liquid with a pipette. Repeat three times.
3. Add 850 μl 4% paraformaldehyde to the empty wells. Place the chambers into the wells and fix for 20min.
4. Repeat step 2 after the fixation is finished.
5. Add 650 μl of Giemsa stain to the empty wells. Place the chambers in them and stain overnight at room temperature.
6. Repeat step 2 after staining.
7. Use a cotton swab to gently aspirate the cells and Matrigel in the upper chamber.
8. Observe it with a microscope.

Note: Experimental conditions should be adjusted in detail according to the actual situation.

• Wound healing

Introduction

We performed this experiment to verify that miR-21-5p promotes the proliferation of breast cancer cells.

Reagents:

• PBS
• Serum-free medium
• Cells
• OPti-Medium
• RNA iMax
• Mimic-21-5p

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• Six-well plate
• Thermostatic incubator

Procedure

1. Take a six-well plate and mark three parallel lines on the bottom. Label the corners with information about each well.
2. Cells were plated in a general cell density of 5*105 cells per well. Overexpression conditions were:
   • 950μl OPti-Medium + 5μl RNA iMax for 5min
   • Add mimic-21-5p 5ul (1OD mimic-21-5p + 125 μl DEPC H2O) for 20min.
3. In conjunction with the actual overexpression time required, when the cells are full grown, the six-well plate is withdrawn and three parallel lines are drawn with the tips along the previously drawn straight line.
4. Wash slowly with PBS and add 3mL of serum-free medium. Select the spot for photographing with an inverted microscope, and mark it as 0h.

Note: Experimental conditions should be adjusted in detail according to the actual situation.

• CRISPR/Cas13a fluorescent assay

Section 1: Collateral cleavage activity corresponding to different crRNAs

Introduction

To determine the best crRNA that we designed, we used four crRNA sequences designed by us for FAM-BHQ RNA probe cleavage, so that we can test the collateral cleavage activity of different crRNAs stimulated by the guidance of a single-stranded RNA like miRNAs.

Reagents and Equipment

Reagents:

• ddH2O
• 10 × Cas13a Reaction Buffer
• RNase inhibitor (40U)
• crRNA-21-5p (1, 2, 3, full-length, 0.4μM)
• LwaCas13a protein (2μM)
• miRNA-21-5p (1μM)
• Fluorescence Reporter (1μM)

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• 96-well black microplate
• Multi-function enzyme immunoassay analyzer

Procedure

System 1

Reagent	NC	CR - 1	CR - 2	CR - 3	CR - fl
ddH2O	12 μL	10 μL	10 μL	10 μL	10 μL

System 2

Reagent	Quantity
miRNA-21-5p (1μM)	2 μL
Fluorescence Reporter (1μM)	4 μL
ddH2O	14 μL

Formulate Reaction System 1 and Reaction System 2 on ice, centrifuge and mix, blow to homogeneity, then sample into a ninety-six well plate and analyze in an immunoenzymology analyzer.

Section 2: Collateral cleavage activity of different miRNA concentrations

Introduction

We established different concentration gradients (miRNA concentrations of 0nM, 25nM, 50nM, 100nM) to test the optimal miRNA concentration for activating the CRISPR-Cas system.

Reagents and Equipment

Reagents:

• ddH2O
• 10 × Cas13a Reaction Buffer
• RNase inhibitor (40U)
• crRNA-21-5p (1, 2, 3, full-length, 0.4μM)
• LwaCas13a protein (2μM)
• miRNA-21-5p (1μM)
• Fluorescence Reporter (1μM)

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• 96-well black microplate
• Multi-function enzyme immunoassay analyzer

Procedure

System 1

Reagent	NC	CR - 1	CR - 2	CR - 3	CR - fl
ddH2O	12 μL	10 μL	10 μL	10 μL	10 μL
10 × Cas13a Reaction Buffer	4 μL	4 μL	4 μL	4 μL	4 μL
RNase inhibitor (40U)	2 μL	2 μL	2 μL	2 μL	2 μL
crRNA-21-5p (0.4μM)	0 μL	2 μL crRNA-21-5p-1	2 μL crRNA-21-5p-2	2 μL crRNA-21-5p-3	2 μL crRNA-21-5p-fl
LwaCas13a protein (2μM)	2 μL	2 μL	2 μL	2 μL	2 μL
Total	20 μL	20 μL	20 μL	20 μL	20 μL

System 2

Reagent	NC	miR(10nM)	miR(25nM)	miR(50nM)	miR(100nM)	miR(200nM)
ddH2O	16 μL	12 μL	6 μL	14 μL	12 μL	8 μL
miRNA-21-5p	0 μL	4 μL * 0.1 μM	10 μL * 0.1 μM	2 μL * 1 μM	4 μL * 1 μM	8 μL * 1 μM
Fluorescence Reporter (1μM)	4 μL	4 μL	4 μL	4 μL	4 μL	4 μL
Total	20 μL	20 μL	20 μL	20 μL	20 μL	20 μL

Formulate Reaction System 1 and Reaction System 2 on ice, centrifuge and mix, blow to homogeneity, then sample into a ninety-six well plate and analyze in an immunoenzymology analyzer.

Section 3: Experimental validation of enzymatic reaction kinetics

Introduction

We tested the changes in fluorescence intensity induced by different concentration gradients of Reporter RNA (0nM, 100nM, 125nM, 250nM, 500nM) over time.

Reagents and Equipment

Reagents:

• ddH2O
• 10 × Cas13a Reaction Buffer
• RNase inhibitor (40U)
• crRNA-21-5p (1, 2, 3, full-length, 0.4μM)
• LwaCas13a protein (2μM)
• miRNA-21-5p (1μM)
• Fluorescence Reporter (1μM)

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• 96-well black microplate
• Multi-function enzyme immunoassay analyzer

Procedure

System 1

Reagent	Quantity
ddH2O	10 μL
10 × Cas13a Reaction Buffer	4 μL
RNase inhibitor (40U)	2 μL
crRNA-21-5p (0.4μM)	2 μL
LwaCas13a protein (2μM)	2 μL
Total	20 μL

System 2

Reagent	NC	Reporter (100nM)	Reporter (125nM)	Reporter (167nM)	Reporter (250nM)	Reporter (500nM)
ddH2O	18 μL	14 μL	13 μL	14 μL	16 μL	16 μL
miRNA-21-5p	2 μL	2 μL	2 μL	2 μL	2 μL	2 μL
Fluorescence Reporter (1μM)	0 μL	4 μL * 1 μM	5 μL * 1 μM	4 μL * 5/3 μM	2 μL * 5 μM	2 μL * 10 μM
Total	20 μL	20 μL	20 μL	20 μL	20 μL	20 μL

Formulate Reaction System 1 and Reaction System 2 on ice, centrifuge and mix, blow to homogeneity, then sample into a ninety-six well plate and analyze in an immunoenzymology analyzer.

• Lateral flow strips

Introduction

We established different concentration gradients (miRNA concentrations of 0nM, 5nM, 25nM, 50nM, 100nM) to demonstrate the feasibility of the test strip and the discrimination of the test strip between high and low concentrations of miRNA.

Reagents and Equipment

Reagents:

• ddH2O
• 10 × Cas13a Reaction Buffer
• RNase inhibitor (40U)
• crRNA-21-5p full-length (0.4μM)
• LwaCas13a protein (2μM)
• miRNA-21-5p (1μM)
• Reporter (2μM)

Equipment:

• Pipette & tips
• RNase free microcentrifuge tubes
• Microcentrifuges
• Test paper

Procedure

System 1 (Working solution)

Reagent	Volume
ddH2O	5 μL
10 × Cas13a Reaction Buffer	2 μL
RNase inhibitor (40U)	1 μL
crRNA-21-5p (0.4μM)	1 μL
LwaCas13a protein (2μM)	1 μL
Total	10 μL

System 2 (Sample solution)

Reagent	NC	miR(5nM)	miR(25nM)	miR(50nM)	miR(100nM)
10 × Cas13a Reaction Buffer	2 μL	2 μL	2 μL	2 μL	2 μL
RNase inhibitor (40U)	1 μL	1 μL	1 μL	1 μL	1 μL
miRNA-21-5p (1μM)	0 μL	0.1 μL	0.5 μL	1 μL	2 μL
Reporter (2μM)	2.4 μL	2.4 μL	2.4 μL	2.4 μL	2.4 μL
ddH2O	Up to 10 μL	Up to 10 μL	Up to 10 μL	Up to 10 μL	Up to 10 μL

After mixing the working solution and the sample solution, the reaction solution was obtained, and the reaction droplets were added to the sample pad of the test strip. The result was recorded in 3 minutes.

Primers

• Primers

Primer Name	Sequence
Primer Loop R	AGGTCTCTCCCTTCGTTTTTGGGGTAGTCTAAATCTATAGTGAGTCGTATTACTCTAGAAGCGGCCGCGAATTC
Primer Loop F	AGGTCTCAGAAGATCCTTTGATCTTTTCTACGGGGTCTG
Primer Spacer R	AGGTCTCACTTCTTGAGATCCTTTTTTTCTGCGCGTAAT
Primer Spacer F(full length)	AGGTCTCAAGGGGACTAAAACTCAACATCAGTCTGATAAGCTACAGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
Primer Spacer F(1)	AGGTCTCAAGGGGACTAAAACCAACATCAGTCTGATAAGCTCAGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
Primer Spacer F(2)	AGGTCTCAAGGGGACTAAAACAACATCAGTCTGATAAGCTACAGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
Primer Spacer F(3)	AGGTCTCAAGGGGACTAAAACTCAACATCAGTCTGATAAGCCAGAGAAGAGCTACTAGTAGCGGCCGCTGCAG
Primer Backbone R	AGGTCTCACTCTAGAAGCGGCCGCGAATTC
Primer Backbone F	AGGTCTCATACTAGTAGCGGCCGCTGCAG
Primer LacI R	AGGTCTCAAGTAACAGTCATAAGTGCGGC
Primer LacI F	AGGTCTCACACCGATGGGGAAGATCG
Primer Cas R	AGGTCTCAGGTGATGTCGGCGATATAGG
Primer Cas F	AGGTCTCAAGAGCAAAAAACCCCTCAAGAC
Primer VR	ATTACCGCCTTTGAGTGAGC
Primer VF2	TGCCACCTGACGTCTAAGAA
Primer CHECK R	CACGAGAAGTACAAGATCCGCGAGTAC
Primer CHECK F	AGTACTCGCGGATCTTGTACTTCTCGTG