1.1 Preparation of competent cells of escherichia coli by TB method

1. The preserved E. coli strain was taken out, scribed on LB solid medium, and activated cultured at 37 ℃ for about 12 hours;
2. The activated single colonies were picked and inoculated into NZY liquid medium at 18 ℃and 250 rpm until OD 600 ≈ 0.7.
3. The bacterial liquid was transferred into a centrifuge tube, allowed to stand on ice for 15 minutes, and centrifuged at 4 ℃and 6000 rpm for 5 minutes to collect bacterial cells;
4. Re-suspending bacteria with pre-cooled TB buffer solution, standing on ice for 30 minutes, and vigorously mixing the bacteria solution at intervals of 5 minutes;
5. Collect thallus by centrifuge at 6000 rpm for 5 minutes at 4° c;
6. The cells were re-suspended in pre-cooled TB buffer, and DMSO was added to a final concentration of 7% and mixed gently.
7. Subpackaging into pre-cooled lyophilized tube, and storing at-80 C.

1.2 Transformation of e. coli

1.2.1 Conventional conversion

1. Then, 100 μL freshly melted competent E. coli cells and 10 μL ligation products were mixed gently in a pre-cooled centrifuge tube and allowed to stand on ice for 30 minutes.
2. 42℃, water bath for 45 seconds, quickly put back on the ice let stand for 2 minutes;
3. Then 200 μL pre-cooled NZY liquid medium was added and mixed gently.
4. Culture at 37 ℃ at 250 rpm for 1 hour;
5. A proper amount of bacterial liquid was applied to LB solid medium containing the corresponding antibiotics and cultured at 37 ℃for about 12 hours.

1.2.2 Fast conversion

1. Then 20 μL freshly melted competent E. coli cells and 2 μL plasmid were mixed gently in a pre-cooled centrifuge tube and allowed to stand on ice for 6 minutes.
2. A proper amount of bacterial liquid was applied to LB solid medium containing the corresponding antibiotics and cultured at 37 ℃for about 12 hours.

1.3 Extraction plasmid

1. Collecting bacterial liquid;
2. Centrifuge at 12000rpm for 2min, and discarding that supernatant;
3. Add 250μl buffers (pre-cooled) to the centrifuge tube, and swirl until the bacterial liquid is fully suspended;
4. Add 250μl BufferLS to the suspension, and mix gently upside down for 6-8 times, and the solution becomes transparent and relatively viscous.
5. Then 350μlBuffer BS was added to obtain a white mass, which was then mixed upside down gently for 6 to 8 times.
6. Standing for 2min, centrifuging at 12000rpm for 10 min at room temperature, and collecting the supernatant;
7. Transfer the above solution to Piasmid DNA Mini Column, allow to stand for 1min, centrifuge at 12000rpm for 1min, and discard the filtrate.
8. Add 500μl of Buffer WA to Mini Column, centrifuge at 12000rpm for 1min, and discard the filtrate.
9. Add 750μl Buffer WB to Mini Column, centrifuge at 12000rpm for 1min, and discard the filtrate.
10. Repeat 9;
11. Centrifuge the minicolumn at 12000 rpm for 2 min;
12. Place Mini Column in a new 1.5ml centrifuge tube, add 50μl sterilized water to the center of the filter membrane, and allow to stand for 1min (no elution filtrate was observed basically; the filtrate appeared after centrifuging at 12000rpm for 2min).
13. The lower filtrate was added to the center of the membrane, allowed to stand for 2min at room temperature, and DNA was eluted by centrifuging at 12000rpm for 2min.

1.4 Recovery of linearize DNA fragments by ethanol precipitation

1. Diluting the DNA to be purified to an appropriate volume, adding an equal volume of chloroform, fully mixing, and standing for 10 minutes;
2. Centrifuge at 12000 rpm for 10 minutes and slowly draw the supernatant into a new centrifuge tube;
3. Adde 2 times of volume ethanol, mix, standing for 30 minutes at that temperature of minus 20 ℃;
4. Centrifuge at 12000 rpm for 15 minutes and discard that supernatant;
5. After 600 μL pre-cooled 75% ethanol was added, it was mixed evenly, centrifuged at 12000 rpm for 5 minutes, the supernatant was discarded, and 200 μL spear head was used to blot out as much as possible.
6. The centrifuge tube was placed at 37 ℃for drying and appropriate amount of double distilled water was added for dissolution and storage at-20 C.

1.5 Recovery of linearize DNA fragments by gel electrophoresis

1. After DNA electrophoresis, the gel containing the DNA fragment of interest was quickly cut off under an ultraviolet lamp. It is recommended that the liquid on the surface of the gel be sucked up and cut up with a paper towel, and that any excess gel be removed as far as possible. The gel was weighed (excluding the empty tube weight) and 100mg of gel was equivalent to 100μL of volume as one gel volume.
2. Add an equal volume of Buffer GDP. Water bath at 50–55 ℃for 7–10 min, and adjust the time appropriately according to the gel size to ensure the complete dissolution of the gel block. During the water bath, the sols were accelerated by reversing and blending twice. (1–3 times the volume of Buffer GDP does not affect DNA recovery. If the recovery of DNA fragments less than or equal to 100 bp, add 3 times the volume of Buffer GDP, water bath after sol, add 1 time the gel volume of isopropanol, after mixing again according to the step 3.
3. Collect the droplets on the tube wall by briefly centrifuging. The FastPure DNA Mini Columns-G adsorption column was placed in a 2 mL collection tube of Collection Tubes, and ≤700μL of sol-gel was transferred to the adsorption column and centrifuged at 12000rpm(13400×g) for 30-60sec. If the sol volume was greater than 700 μL, the adsorption column was returned to the collection tube, and the remaining sol liquid was transferred to the adsorption column and centrifuged at 12,000 rpm (13,400 × g) for 30 to 60 sec.
4. Discarding the filtrate, and placing the adsorption column into a collection tube. Add 300 μL Buffer GDP to the adsorption column. Allow to stand for 1min. Centrifuge at 12000rpm(13400×g) for 30-60sec.
5. Discarding the filtrate, and placing the adsorption column into a collection tube. Add 700 μL Buffer GW (anhydrous ethanol has been added) to the adsorption column. Centrifuge at 12000rpm(13400×g) for 30-60sec. (Please add Buffer GW along the periphery of the adsorption column wall, or add Buffer GW and mix with the cover upside down for 2 to 3 times to help completely rinse the salt adhered to the tube wall. )
6. Repeat step 5. (the use of Buffer GW for two flushes can ensure the complete removal of salts and eliminate the influence on subsequent experiments.) )
7. Discard the filtrate and put the adsorption column back into the collection tube. Centrifuge at 12000rpm(13400×g) for 2min.
8. Place the adsorption column in a sterilized 1.5 mL centrifuge tube, add 20-30 μ L of Elution Buffer to the center of the column, place for 2 min, and centrifuge at 12 000 rpm (13400 × g) for 1min. The adsorption column was discard and that DNA was stored at ℃ .. (If maximum throughput is required, it is recommended that the resulting solution be reintroduced into the centrifuge column and repeat Step 8 for a second elution. When fragments larger than 3kb are recovered, it is recommended that the Elution Buffer be preheated to 55 ℃to increase the recovery efficiency. )

1.6 PCR reaction amplified DNA

The PCR reaction system and procedures were performed according to the following table.

Table 1-1 PCR reaction system table

material	Volume (μL)
Ex Taq DNA polymerase (5 U/μL)	0.3
Template DNA	0.7
Forward primer (10 mM)	2.5
Reverse primer (10 mM)	2.5
dNTP（2.5 mM each）	four
10×Ex Taq Buffer（Mg2+ Plus, 20 mM）	five
Double distilled water	35

Table 1-2 PCR reaction program table

Note in the table: A: annealing temperature is determined by the Tm value of primers, and the temperature with small Tm value in two primers is generally taken as the annealing temperature; b：
The extension time is determine by that length of the amplified fragment and is generally calculated at an extension rate of 1 kb/ minute.

procedure	temperature	time	Number of cycles
Predenaturation	95℃	5 minutes	1 time
Cycle: denaturation	95℃	30 seconds	30 times
Cycle: annealing	The value of that prim Tm determines a	30 seconds
Cycles: extension	72℃	Amplified fragment length decision b
polishing	72℃	5 minutes	1 time
preserve	4 ℃		1 time

1.7 Enzyme digestion of DNA fragments

1. The first enzyme digestion was conducted as follows: reaction temperature 37℃ and reaction time 1 h;

plasmid	buffer 10×H	SalⅠ	water
5μL	5μL	1μL	39μL

2. Carry out gum recovery on that enzyme-cut product;
3. The first enzyme digestion was conducted according to the following system, with the reaction temperature of 25℃ and time of 20min.

plasmid	NE Buffer	SWAⅠ	water
12μL	5μL	1μL	32μL

1.8 Connection of DNA fragments

The enzyme linkage reaction system was 20 μL, and the enzyme linkage was operated as follows: reaction temperature 37℃, and reaction time 30min.

carrier	5×CEⅡ Buffer	ExnaseⅡ	BCE	water
2μL	4μL	2μL	1μL	11μL

1.9 Construction of expression strain of saccharomyces cerevisiae

1.9.1 Construction of fusion gene bce

Using the vectors pHBM368-pgk-bg, pHBM368-pgk-cbh and pHBM368-pgk-eg as templates, the CD coding sequences of the catalytic domains of cellulase BG, CBH and EG were obtained by PCR reaction, with the primers shown below.

Table 1-3 primer summary table for constructing saccharomyces cerevisiae expression vector

Table note: bold for the enzyme cutting site; The italicized sequence is the reverse-coded sequence for flex connector (G4S)3 (i.e., GGGGSGGGGSGGGGS).

Amplified sequence	Primer name	Primer sequence (5'→3')	Tm value (c)	Length (kb)
BG	BG-SnaB I-F	ATGTACGTAAGTAATCCGTTCCCCGAC	61.1	1.40
BG-L-Xba I-R	ATCTAGACGAGCCACCGCCACCCGACCCACCACCGCCCGAGCCACCGCCACCCCCCAGGCACGCCCCATT	82.6
CBH	CBH-Xba I-F	ACTTCTAGACAGGGAAATCAGGATTTC	58.1	0.97
CBH-L-EcoR I-R	AGAATTCCGAGCCACCGCCACCCGACCCACCACCGCCCGAGCCACCGCCACCATAAGTGCTATCAATCGGA	78.8
EG	EG-EcoR I-F	ATCGAATTCCAGTCGCTTTGCGACCAAT	61.1	0.69
EG-Eco81 I-R	ACTCCTGAGGCTAGTTGTTTTGTTGGGCGGA	64.9

The PCR product was recovered by ethanol precipitation and treated with the corresponding restriction endonuclease. BG was digested by Xba I, CBH was digested by Xba I and EcoR I, and CBH was digested by ECOR I. The fragments after enzyme digestion were recovered by gel electrophoresis, and mixed according to the mass concentration of equivalents and added into the ligation reaction system. Using the enzyme linkage mixture as the template, and using the primers BG-SnaB I-F and EG-Eco81 I-R, a fragment with a length of about 3.0 kb was obtained by PCR amplification, namely, the fusion gene bce.

1.9.2 Cloning and verification

1. Performing enzyme cutting treatment on the fusion gene bce fragment and the vector, performing agarose gel electrophoresis detection and performing gel recovery;
2. The recovered fragments were mixed according to a certain mass concentration ratio (DNA fragments: linearized vector = 10: 1) and added into a linking reaction system;
3. After completion of the ligation reaction, E. coli XL10-Gold competent cells were routinely transformed, coated into LB solid medium (with 100 mg/mL ampicillin added) and incubated at 37 ℃ for approximately 12 hours;
4. The selected individual colonies were incubated in a centrifuge tube containing 1 mL of LB liquid medium (with 100 mg/mL ampicillin). The plasmid of E. coli transformant was extracted, digested with the restriction endonuclease EcoR I, and detected by agarose gel electrophoresis.

1.9.3 Preparation of competent cells of saccharomyces cerevisiae

1. The preserved S. cerevisiae INVSc1 strain was taken out, scribed on YPD solid medium, and activated and cultured at 28 ℃ for about 24 hours.
2. The activated single colonies were picked and inoculated into YPD liquid medium at 28 ℃ and 220 rpm until OD 600 ≈ 1.0.
3. The bacterial liquid was transferred to a centrifuge tube, allowed to stand on ice for 15 minutes, and centrifuged at 4 ℃ at 4000 rpm for 1 minute to collect bacterial cells;
4. Re-suspending the thalli with pre-cooled double distilled water, centrifuging at 4 ℃ for 1 minute at 4000 rpm to collect the thalli;
5. Repeat the previous step;
6. The cells were resuspended with pre-cooled 1 M sorbitol solution, allowed to stand on ice for 15 minutes, and centrifuged at 4 ℃ at 4000 rpm for 30 seconds to collect the cells.
7. Re-suspending thallus with pre-cooled 1 M sorbitol solution, and uniformly mixing the bacterial solution to obtain saccharomyces cerevisiae competent cells; Low temperature storage, time should not be too long, it is best to prepare immediately after the conversion.

1.9.4 Electric shock transformation of saccharomyces cerevisiae

1. After 100 μL of the carrier to be converted was treated with restriction endonuclease Hpa I, it was recovered by ethanol precipitation method and dissolved in 10 μL double distilled water.
2. Mix 100 μL freshly prepared S. cerevisiae INVSc1 competent cells with the recovered linearized carrier gently in a pre-cooled centrifuge tube, and allow to stand on ice for 5 minutes.
3. Setting the parameters of the electric rotator to 1800V and 5ms, adding the mixture into a pre-cooled electric rotator cup, connecting electrodes, and performing electric shock;
4. Quickly taking out the electric rotor, slowly adding 1 mL of pre-cooled 1 M sorbitol solution, gently mixing, immediately placing on ice, and standing for 5 minutes;
5. A proper amount of bacterial liquid was applied to SC solid medium and cultured at 28 ℃ for about 4 days.

1.10 Screening and identification of recombinant saccharomyces cerevisiae

1.10.1 Plate screening of recombinant saccharomyces cerevisiae

1. Single colonies of S. cerevisiae which could grow on SC solid medium were selected and inoculated on YPD solid medium, and the original strain of S. cerevisiae INVSc1 was selected as the control at the same time and cultured at 28 ℃ for about one day.
2. The activated single colonies were picked and inoculated on YPC- phenol blue solid medium for culture at 28 ℃ for about 4 days.
3. The growth of colonies and the size of the hydrolysis circle were observed, and the colonies that grew normally and formed with the hydrolysis circle were the recombinant S. cerevisiae strain.

1.10.2 Expression of cellulase in saccharomyces cerevisiae

1. The single colony of recombinant S. cerevisiae obtained after screening was picked and inoculated into a 250 mL conical flask fitted with 50 mL of YPD liquid culture medium, and cultured at 28 ℃ and 220 rpm until OD 600 ≈ 1.0;
2. The activated bacterial solutions were inoculated into 500 mL conical flasks filled with 100 mL of YPD liquid medium, and the inoculation amount (about 5 mL) was controlled to maintain the same initial concentration of each group of bacterial solutions. Then, the samples were cultured at 28 ℃ and 220 rpm for 2 days.
3. Then the mixture was centrifuged at 8000 rpm for 10 min at 4 ℃ and the supernatant was taken out as extracellular enzyme solution which was stored at 4 C.

1.10.3 Validation of recombinant strain by colony PCR

The screened recombinant S. cerevisiae was selected with a clean toothpick into a PCR tube, and re-suspended in 20 μL double distilled water. Heat at 98 ℃ for 5 min by PCR instrument, transferred to-80 ℃ and allow to stand for 5 min. After three replicates, 0.5 μL was used as the template for PCR using the primers BG-SnaB I-F and EG-Eco81 I-R.

1.10.4 SDS- polyacrylamide gel electrophoresis

Preparation of polyacrylamide gel

Slowly add the prepared separation gel (see Table 1-4) into a 1.0 mm glass bath along the edge until the liquid level is 0.5-1.0 cm away from the comb teeth. Add the double distilled water seal gum and allow to stand for 30-60 minutes until the gel polymerizes.

After the aqueous layer is removed, quickly add the prepared concentrated gel (see Table 1-5) to a glass bath, insert the comb teeth in parallel, and allow to stand for about 30 minutes at room temperature until the gel polymerizes. Gently pull out the comb, and put the rubber plate into the electrophoresis tank, and add the electrophoresis buffer, so that the upper and lower ends of the rubber are immersed in the buffer.

Table 1-4 SDS-PAGE 8% Separation Rubber Formulation Table

component	Volume mL
Double distilled water	4.6
30% Acr-Bis （29:1）	2.7
1.5 M Tris-HCl （pH 8.8）	2.5
10% SDS	0.1
10% ammonium persulfate	0.1
TEMED	0.006

Table 1-5 SDS-PAGE 5% concentrated gel formula table

component	Volume mL
Double distilled water	6.8
30% Acr-Bis （29:1）	1.7
1.0 M Tris-HCl （pH 8.8）	1.25
10% SDS	0.1
10% ammonium persulfate	0.1
TEMED	0.006

Processing, loading and electrophoresis

The extracellular enzyme solution and 4× protein SDS-PAGE loading buffer were taken, mixed evenly in the ratio of 1:3, treated at 100 ℃ for 10 minutes, and then slowly added into the sample well after cooling on ice, namely, ready-to-use protein molecular weight standard (Broad) was used for simultaneous loading.

Turn on the power supply, starting current 20 mA. When bromophenol blue reached the separation gel, a current of 30 mA was set. When bromophenol blue is close to the bottom of the electrophoresis tank, disconnect the power supply.

Dyeing and decolouring

After electrophoresis, the separation gel was separated from the glass plate, put into Coomassie brilliant blue R-250 staining solution, and stained for 6–8 hours at room temperature; then, the separation gel was immersed into the decolorizing solution, and shaken for decolorization at 20 rpm until the bands on the gel became clear.

1.11 Determination of standard curve

1.11.1 Determination of standard curve of glucose

1. Accurately weighing 10.0 mg of glucose, dissolving in double distilled water, and regulating the volume to 10 mL in a volumetric flask to obtain a 1 mg/mL glucose standard solution;
2. The standard solutions were diluted with double distilled water into glucose standard solutions at concentrations of 0 mg/mL , 0.2 mg/mL, 0.4 mg/mL, 0.6 mg/mL, 0.8 mg/mL, and 1.0 mg/mL, respectively.
3. Separately, 200 μL of the above standard solutions were mixed with 400 μ L of DNS reagent, and then placed in a boiling water bath for 5 minutes.
4. After cooling on ice for 2 min, 200 μL reaction solution was added into a dry and clean ELISA plate, and OD540； of glucose solution at each concentration was measured with an ELISA reader.
5. Standard curves were drawn with the OD 540 value as the ordinate and the glucose concentration value as the abscissa.

1.11.2 Determination of PNPG standard curve

1. Accurately weighing 27.8 mg of PNP, dissolving in double distilled water, and regulating the volume to 10 mL in a volumetric flask to obtain 20 mmol/L PNP standard mother solution;
2. The mother liquor was diluted with double distilled water into PNP standard solutions at concentrations of 0 mmol/L (i.e., double distilled water), 0.2 mmol/L, 0.4 mmol/L, 0.6 mmol/L, 0.8 mmol/L and 1.0 mmol/L, respectively.
3. Then 500 μL of the standard solutions were added with 500 μ L of 1 M sodium carbonate solution, mixed evenly and reacted for 5 minutes at room temperature.
4. Then 200 μL reaction solutions were added into a dry and clean ELISA plate, and the absorbance of each group's reaction solutions at 405 nm was measured with an ELISA reader.
5. Standard curves were drawn with the OD405 value as the ordinate and the PNP concentration value as the abscissa.

1.12 Determination of enzyme activity

1.12.1 Determination of β -glucosidase activity

After 50 μL of extracellular enzyme solution was added with 950 μL 5mM PNPG for reaction at 45 ℃ for 15 minutes, 400 μL was immediately added into a centrifuge tube containing 400 μ L of 1 M sodium carbonate solution for thorough mixing and OD405 was determined.

Enzyme activity unit definition: The amount of enzyme required to produce 1 μmol PNP per hour of reaction is 1 U.

1.12.2 Determination of exoglucanase activity

After 50 μL of extracellular enzyme solution was mixed with 950 μ L of 1% (w/v) MCC, the mixture was reacted at 45 ℃for 1 hour, and immediately after that, 200 μL of extracellular enzyme solution was mixed in a centrifuge tube containing 400 μ L of DNS reagent. After that, the mixture was immersed in a metal bath at 100 ℃ for 10 minutes, cooled on ice for 5 minutes, and OD540 was measured.

Enzyme activity unit definition: The amount of enzyme required to react to produce 1 μmol of reducing sugar per hour is 1 U.

1.12.3 Determination of endoglucanase activity

After 50 μL of extracellular enzyme solution was added with 950 μ L of 1% (w/v) CMC for reaction at 45 ℃ for 30 minutes, 200 μL was immediately added into a centrifuge tube containing 400 μ L of DNS reagent for thorough mixing. After metal bath at 100 ℃ for 10 minutes and ice cooling for 5 minutes, OD540 was measured.

Enzyme activity unit definition: The amount of enzyme required to react to produce 1 μmol of reducing sugar per hour is 1 U.

1.12.4 Determination of filter paper enzyme activity

To 50 μL of extracellular enzyme solution, 950 μL citric acid buffer was added, together with two small Whatman NO.1 filter papers (about 0.5 mg). After reacting for 1 hour at 45 ℃, 200 μL was immediately added into a centrifuge tube containing 400 μ L of DNS reagent and fully mixed. After the mixture was immersed in a metal bath at 100 ℃ for 10 minutes, it was cooled on ice for 5 minutes to determine OD540.

Definition of enzyme activity unit: The amount of enzyme required to produce 1 μmol of reducing sugar per hour of reaction is 1 U.

2.1 sequentialermr pronepcr

Perform error-prone PCR and temperature gradient PCR as per the following table.

Note: dATP: 10 mm; dCTP：10mM; dGTP：10mM； dTTP：100mM； MnCl2：5mM; MgCl2：50mM； Pri.F/Pri.R：20mM; BSA：0.1μg/μL

Temp（℃）	95	94	fifty-two	seventy-two	seventy-two	32cycles
Time（min）	five	0.5	50 s	one	10

The PCR products were detected by agarose gel electrophoresis, and the target band was recovered by gel filtration and integrated with the vector, which was often transferred to the competence of Escherichia coli BL21. Screening was then performed using RBB- xylan plates.

The bacteria with the largest and most obvious hydrolysis circle were selected and inoculated into 200mL LB liquid medium for culture in a 37 ℃ shake flask for about 12 h. The protein position was detected by SDS-polyacrylamide gel electrophoresis.

2.2 Cell disruption

1. Centrifuge collection The bacterial liquid was collected into a 50ml centrifuge tube and centrifuged at 8000rpm for 4min;
2. Bacterial wash PH7.0, 20ml of 0.2M PBS buffer was carried out twice;
3. Lysis buffer was prepared by adding. 200ml,20–30 mL lysis buffer was added into each centrifuge tube and mixed with shaking;
4. Pre-cooling on ice for 1–2 h (shaking at intervals);
5. Control the crusher. Change bar: 6 gear; ultrasonic on time: 1s; ultrasonic off time: 2s (switching time ratio is 1:2); alarm temperature: 50℃; power: 20%; duration: 35-40min; centrifuge crushing solution at 8000 rmp, take supernatant for 10min (save supernatant 4℃).

2.3 Extraction and purification of protease

2.3.1 Ni column rebirth

1. Rinse the Ni column with 8 x the volume of stripping buffer until it turns white;
2. The Ni column was rinsed with a 10 x-volume of deionized water;
3. Wash the Ni column with 2 x the volume of deionized water;
4. The Ni column was washed with a 10 x volume of buffer (PH 7.0,20mM PBS).

2.3.2 The Ni columns were isolated and purified

1. Pour the sample into the reborn Ni column and mix well;
2. Two lattice flow rate to the sample will be exhausted;
3. The miscellaneous proteins were eluted with 20 mM imidazole, 0.5M NaCl of PBS dissolved in PH 7.0;
4. The protein was eluted with 400 mM imidazole, 0.5M NaCl, and the eluted liquid was collected into the centrifuge tube; (the elution was determined by sampling and mixed with G250)
5. After elution, rinse twice with buffer, rinse twice with deionized water, and seal the column with 20% ethanol;
6. Rinse the Ni column with 10 x the volume of deionized water;
7. Wash the Ni column with 2 x the volume of deionized water;
8. The Ni column was washed with a 10 x volume of buffer (PH 7.0,20mM PBS).

2.3.3 Protein ultrafiltration

1. Pour the sample into the reborn Ni column, fully mix well and soak the ultrafiltration tube with 0.1M NaOH for 30min;
2. Two pure water washing centrifugation, 10-15min, 3000 rcf, down 3 gear;
3. Sample loading, collect and concentrate;
4. Rinsed with 1-1.5ml buffer for 30-40min, 2-3 times;
5. NaOH Soak the ultrafiltration tubes for 30min, washed and sealed with 20% ethanol.

2.4 Determination of xylanase activity

1. The purified enzyme solution was divided into three groups:

①100μl substrate (containing 1% xylan mixed with water) +20μl enzyme solution;

②100μl water +20μl enzyme solution;

③100μl substrate +20μl water;

2. ①②③Three groups reacted for 5 minutes in a 60 ℃ water bath;
3. The samples were centrifuged for 1min;
4. 60ul of reaction solution+60μl of DNS was reacted at 100 ℃ for 10min, and 120 μl of each group was added into the grid;
5. Preparation of standard curve: 1mg/mL glucose mother solution was prepared and 60μl of solutions with different concentrations of 0, 0.2, 0.4, 0.6, 0.8 and 1.0mg/mL were reacted with 60μlDNS respectively at 100 ℃ for 10min. Then 120μl of reaction solution was added into the grid. Enzyme activity was measured by ELISA reader: single wavelength was 540nm.

3.1 Construction of engineered S. cerevisiae strains

Plasmids pHM368-P_PGK-xylA-Ura, pHM368-P_ADH1-xylA-Ura, pHM368-P_GAPDH-xylA-Ura, pHM368-P_PDC1-xylA-Ura and pHM368-P_TEF1-xylA-Ura were linearized with HpaⅠand transformed into INVSc1 using the lithium acetate method to obtain engineered strains INVSc1/pHM368-P_PGK-xylA, INVSc1/pHM368-P_ADH1-xylA, INVSc1/pHM368-P_GAPDH-xylA, INVSc1/pHM368-P_PDC1-xylA and INVSc1/pHM368-P_TEF1-xylA, respectively. The transformants were selected on SD plates without Ura and then validated by polymerase chain reaction (PCR).

3.2 Xylose isomerase activity assay

The expression of xylA in the engineered strains contained different promoters were evaluated. The crude enzyme was obtained after 48-h incubation of the engineered S. cerevisiae strains harboring different promoters in YPD medium. XI activity was measured as described by Tanino et al. with minor adjustments. Briefly, the reaction mixture containing 0.05 mL of 10 mM MnCl2, 0.05 mL of 100 mM xylose and 0.1 mL of crude enzyme was incubated at 75 °C for 20 min. The reaction was stopped by 0.05 mL of 50% (w/v) trichloroacetic-acid (TCA) and then incubated on room temperature for 20 min, followed by adding a dose of cysteine-carbazole-sulfuric acid reagent contained 0.2 mL of 1.5% (w/v) cysteine, 0.2 mL of 0.12% carbazole and 6 mL of 13 M H2SO4 and incubating at 37 °C for 20 min. OD540 was measured to determine the amount of the released xylulose. One unit of XI activity (U) was defined as the amount of enzyme required to produce 1 µg of xylulose per minute under conversion of 1 mL of crude enzyme solution.

3.3 Functions of various promoters in engineered S. cerevisiae strains

Engineered S. cerevisiaestrains harboring different promoters were fermented with the media containing glucose and xylose to evaluate the xylose utilization rates. Cells were collected through centrifugation at 5000 rpm for 2 min and washed twice after growing in YPD medium at 28 °C for 24 h. Then the cells were transferred into 100 mL of SD-G4X10 medium (0.4% Glucose, 1% xylose). Unless otherwise stated, OD₆₀₀ of the cell culture was adjusted to 1 at the initial phase, and the assays were performed with 200 rpm shaking at 28 °C under aerobic conditions.