human-practices
title picture

Experiments

Table of contents

Cloning protocols Bacterial lysate SDS-PAGE protocols Microplastics protocols Biofilm protocols Gel extraction protocols Primers Plasmids Strains

Our Protocols

We decided to divide the work in the laboratory into four clearly defined protocols. This division allows us to efficiently manage the different stages of our project. Each protocol represents a key step in our research process and is designed to address specific aspects of our project. Below you will find each protocol explained in detail, where we outline the procedures and objectives associated with each one.

  • Cloning protocols




  • Bacterial lysate SDS-PAGE protocols




  • Mircroplastics protocols




  • Biofilm protocols




  • Gel extraction protocol

Primers

Primer name Sequence Description
PR_001 gcacgaagtatcattgttatccgctcacaagtcaattgttatccgctcacaattagccctgcaaagtaaactgg PCR primer and promoter for pFM_1300 amplification
PR_002 aattgtgagcggataacaattgacttgtgagcggataacaatgatacttcgtgcTAAATGTACGACCAGGTCCAGG PCR primer with promoter sequence (lower case) for pFM_1300 amplification
PR_003 CGATCAGATTGCCGTGAACC Forward PCR primer for split pFM_1300 amplification
PR_004 GGTACTCACATTGACGACGC Reverse PCR primer for split pFM_1300 amplification
PR_005 GTACTGATGAGCGGTCGCGTTGT Primer without linker and peptide
PR_006 TCCCGCTGCAATCTTTAACG Primer for sequencing the region between primers PR_003 and PR_004
PR_007 ATGTCATTCTGCCGTTCTGC Primer for sequencing the region between primers PR_003 and PR_004
PR_008 cgctgttgagatccagttcg Primer for sequencing the region between primers PR_001 and PR_002
PR_009 AAAGTTTTGAGCCTCCCTGC Primer for sequencing the region between primers PR_001 and PR_002
PR_010 TACATCATTTGTATTACAGAAACAGGGCGCAAG Primer with overhang
PR_011 CTCAATCGATCTGACCCAACG Primer for sequencing the region between primer with plastics peptide
PR_012 TTGCTTCGTCTGACTTTGCC Primer for sequencing the region between primer with plastics peptide
PR_013 TACTGATTGGGTGAACTACGATACTTCCAGAATAACGAGAAATACGCTACTCTTttgacggctagctcagtcctaggtacagtgctagcAATGTACGACCAGGTCCAGG Primer to add constitutive promoter (BBa_J23100) for csgB/A/C + random sequence for overhang
PR_014 gctagcattatacctaggactgagctagctgtcaaagagtcactaagggctaactaact Primer to add constitutive promoter (overhang) associate with PR_015
PR_015 ttgacagctagctcagtcctaggtataatgctagcAGATAACCTCAGGCGATAAAGC Primer to add constitutive promoter (BBa_J23119) for csgD/E/F
PR_016 GGAAGTATCGTAGTTCACCCAATCAGTActgcaaagtaaactggatggc Primer to add constitutive promoter (BBa_J23100) associate with PR_015 + overhang of 20-30 bp of PR_013
PR_017 CCGGAGAATACGATTGCTGC Primer for negative control amplification to delete csgA
PR_018 GCAGCAATCGTATTCTCCGGTGTATTACAGAAACAGGGCGC Primer for negative control amplification to delete csgA
PR_019 aagggaataagggcgacacg Primer for sequencing the region between PR_016 and PR_013
PR_020 aagggaataagggcgacacg Primer for sequencing the region between PR_016 and PR_013
PR_021 TTGCTTCGTCTGACTTTGCC Primer for sequencing region between PR_017 and PR_018
PR_022 GCATATATTGATCAGGCGGGC Primer for sequencing the region between PR_017 and PR_018
PR_023 GTTACCCGTATAGTCACTTTCCC Primer for sequencing the region between PR_015 and PR_014
PR_024 TTATCACAACAATGGCCGCC Primer for sequencing the region between PR_015 and PR_014
PR_025 GAGAACTGCTGCCTGGTAGTAGATAGGTTGTTATTGAGTAAGAAGGTAtctggtaaggttgggaagcc Primer that replace PR_001 (primer + random sequence at the end) for the amplification of pFM_1300
PR_026 TACCTTCTTACTCAATAACAACCTATCTACTACCAGGCAGCAGTTCTCaattgtgagcggataacaattgacttgtgagcggataacaatgatacttcgtgcAATGTACGACCAGGTCCAGG Primer that replace the PR_002 (primer + promoter + random sequence at the end) for the amplification of pFM_1300
PR_027 TTCTTCTGACCTGTAACGAATAaattgtgagcggataacaattgacttgtgagcggataacaatgatacttcgtgcTAAATGTACGACCAGGTCCAGG Primer that replace PR_002 for the amplification of pFM_1300
PR_028 gcacgaagtatcattgttatccgctcacaagtcaattgttatccgctcacaattTATTCGTTACAGGTCAGAAGAAagccctgcaaagtaaactgg Primer that replace PR_001 for the amplification of pFM_1300
PR_029 ATGCTGCAGCAATACACCCT Primer for the amplification of ALS3 gene (rubber domain gene)
PR_030 GATCAGCAGAAGGGTGTATTGCTGCAGCATaccgctaccaccgctaccag Primer for the amplification of the backbone for the rubber domain plasmid
PR_031 TGCTCAATCGTGTAGAAATCTCTTGGATCCttaCTGAACGATTACTGTATCGATACTATCTGT Primer for the amplification of ALS3 gene (rubber domain gene)
PR_032 GGATCCAAGAGATTTCTACACGATTGAGC Primer for the amplification of the backbone for the rubber domain plasmid
PR_033 TAAAGCCCATCCCGACTACC Primers for sequencing of the region between primers PR_031 and PR_032
PR_034 TGTTATCGCTACCCTGTCCC Primers for sequencing the region between primers PR_031 and PR_032
PR_035 CAGGGTAAACGTGTCGCC Primers for sequencing the region between primers PR_029 and PR_030
PR_036 catcatcatcacagcagcgg Primer for sequencing the region between primers PR_029 and PR_030
PR_037 TGCTAACCTTATTCAGCGAA Primer for sequence all the fragment (SpyCatcher + Als3) with PR_036
PR_038 TCACCGCAGGAACGAATACG Primer for sequence all the fragment (SpyCatcher + Als3) with PR_034
PR_041 TTTGGTAACAACGCGACCGCTCATCAGTACggcagcggcggcag Primer to amplify the template for the plasmid with the peptide
PR_042 CATCATTTGTATTACAGAAACAGGG Primer to amplify the backbone for the plasmid with the peptide
PR_043 AGCGGTCGCGTTGTT Primer to amplify the backbone for the plasmid with the peptide
PR_PE1t TCTGTAATACAAATGATGTAttacataacaaaagcagcccgctgaccgcggcgctgccggccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PE1 (assay 1)
template_PE1 ggcagcggcggcagcggccggcagcgccgcggtcagcgggctgcttttgttatgTAA Primer to amplify the template for PE1 (assay 2)
PR_PE1_R GCGCCCTGTTTCTGTAATACAAATGATGTATTAcataacaaaagcagcccgctg Primer to amplify the template for PE1 (assay 2)
PR_PE2t TCTGTAATACAAATGATGTAttacgcccagccgctggttttatgtttccacggcggcaggccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PE2 (assay 1)
template_PE2 ggcagcggcggcagcggcctgccgccgtggaaacataaaaccagcggctgggcgTAA Primer to amplify the template for PE2 (assay 2)
PR_PE2_R GGCTTGCGCCCTGTTTCTGTAATACAAATGATGTATTAcgcccagccgctggt Primer to amplify the template for PE2 (assay 2)
PR_PE3t TCTGTAATACAAATGATGTAttacggcagcagatagctatcgcgcagccaccacggcaggccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PE3 (assay 1)
template_PE3 ggcagcggcggcagcggcctgccgtggtggctgcgcgatagctatctgctgccgTAA Primer to amplify the template for PE3 (assay 2)
PR_PE3_R CTTGCGCCCTGTTTCTGTAATACAAATGATGTATTAcggcagcagatagctatcgc Primer to amplify the template for PE3 (assay 2)
PR_PE4t TCTGTAATACAAATGATGTAttacggccacggcagcggcggatgtttccaccacggccagccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PE4 (assay 1)
template_PE4 ggcagcggcggcagcggctggccgtggtggaaacatccgccgctgccgtggccgtaa Primer to amplify the template for PE4 (assay 2)
PR_PE4_R TTGCGCCCTGTTTCTGTAATACAAATGATGTAttacggccacggcagc Primer to amplify the template for PE4 (assay 2)
PR_PE6t TCTGTAATACAAATGATGTAttacatgcgcagaatcggatgggttttccacgccggccagccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment of the peptide PE6 (assay 1)
template_PE6 ggcagcggcggcagcggctggccggcgtggaaaacccatccgattctgcgcatgtaa Primer to amplify the template for PE6 (assay 2)
PR_PE6_R GCGCCCTGTTTCTGTAATACAAATGATGTAttacatgcgcagaatcggatgg Primer to amplify the template for PE6 (assay 2)
template_PS1 ggcagcggcggcagcggccgcgcgtttattgcgagccgccgcattaaacgcccgTAA Primer to amplify the tamplate for PS1 (assay 2)
PR_PS1_R CGCCCTGTTTCTGTAATACAAATGATGTATTAcgggcgtttaatgcggc Primer to amplify the template for PS1 (assay 2)
PR_PS2t TCTGTAATACAAATGATGTAttacgggcggcgaatgcggcggctcgcaataaacgcgcggccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PS2 (assay 1)
template_PS2 ggcagcggcggcagcggccgcgcgtttattgcgagccgccgcattcgccgcccgtaa Primer to amplify the template for PS2 (assay 2)
PR_PS2_R CGCCCTGTTTCTGTAATACAAATGATGTAttacgggcggcgaatgc Primer to amplify the template (assay 2)
PR_PS3t TCTGTAATACAAATGATGTATTAcagtttcagcagttttttcagcagtttcagcagttttttcaggccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PS3 (assay 1)
template_PS3 ggcagcggcggcagcggcctgaaaaaactgctgaaactgctgaaaaaactgctgaaactgTAA Primer to amplify the template for PS3 (assay 2)
PR_PS3_R CGCCCTGTTTCTGTAATACAAATGATGTATTAcagtttcagcagttttttcagcagt Primer to amplify the template for PS3 (assay 2)
PR_PS3_R CGCCCTGTTTCTGTAATACAAATGATGTATTAcagtttcagcagttttttcagcagt Primer to amplify the template for PS3 (assay 2)
PR_PS4t TCTGTAATACAAATGATGTATTAgcgaattttgctctgcatggtcgggctcgcggtgctggtgccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PS4 (assay 1)
template_PS4 ggcagcggcggcagcggcaccagcaccgcgagcccgaccatgcagagcaaaattcgcTAA Primer to amplify the template for PS4 (assay 2)
PR_PS4_R CGCCCTGTTTCTGTAATACAAATGATGTATTAgcgaattttgctctgcatggtc Primer to amplify the template for PS4 (assay 2)
PR_PS5t TCTGTAATACAAATGATGTATTAgcgcagggtcggaaagttcgcgcgtttcagctgcgcgcgaaacgcgcggcgatagctgcccgcgcgcgggccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PS5 (assay 1)
template_PS5 ggcagcggcggcagcggcccgcgcgcgggcagctatcgccgcgcgtttcgcgcgcagctgaaacgcgcgaactttccgaccctgcgcTAA Primer to amplify the template for PS5 (assay 2)
PR_PS5_R CGCCCTGTTTCTGTAATACAAATGATGTATTAgcgcagggtcggaaagt Primer to amplify the template for PS5 (assay 2)
PR_PP1t TCTGTAATACAAATGATGTAttaaccagcgatattaaaagccgcagcccgcatcatcgcgccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PP1 (assay 1)
template_PP1 ggcagcggcggcagcggcgcgatgatgcgggctgcggcttttaatatcgctggttaa Primer to amplify the template for PP1 (assay 2)
PR_PP1_R CGCCCTGTTTCTGTAATACAAATGATGTAttaaccagcgatattaaaagccgca Primer to amplify the template for PP1 (assay 2)
PR_PP3t TCTGTAATACAAATGATGTAttacgccaggctgcccggcggcaggccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the PP3 (assay 1)
template_PP3 ggcagcggcggcagcggcctgccgccgggcagcctggcgtaa Primer to amplify the template for PP3 (assay 2)
PR_PP3_R GCGCCCTGTTTCTGTAATACAAATGATGTAttacgccaggctgcccg Primer to amplify the template for PP3 (assay 2)
PR_PP5t TCTGTAATACAAATGATGTAttaggtcgcgccatgcgggctcatggtgctcagaatgctgccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with the peptide PP5 (assay 1)
template_PP5 ggcagcggcggcagcggcagcattctgagcaccatgagcccgcatggcgcgacctaa Primer to amplify the template for PP5 (assay 2)
PR_PP5_R CGCCCTGTTTCTGTAATACAAATGATGTAttaggtcgcgccatgcgg Primer to amplify the template for the PP5 (assay 2)
PR_PP6t TCTGTAATACAAATGATGTAttacagcgccggcgcggtgctatggctatatttcatgctgccgctgccgccgctgccGTACTGATGAGCGGTCGCGTTGT Primer to amplify the fragment with peptide PP6 (assay 1)
template_PP6 ggcagcggcggcagcggcagcatgaaatatagccatagcaccgcgccggcgctgtaa Primer to amplify the template for PP6 (assay 2)
PR_PE6_R CGCCCTGTTTCTGTAATACAAATGATGTAttacagcgccggcgc Primer to amplify the template for PP6 (assay 2)


Plasmids

Plasmid name Characteristics Reference or source
pFM_1300 Plasmid we used to clone our engineered plasmid (pFM_indu_ctrl, pFM_pos_Ctrl and pFM_neg_Ctrl) Given to us by Roberto Avendaño Vega, Schaerli Lab
pC3 Used as working plasmid for biofilm production Given to us by Roberto Avendaño Vega, Schaerli Lab
pFM_indu_ctrl IPTG inducible plasmid, with csg operon and ampicillin resistance Engineered by us during this project
pFM_pos_Ctrl Constitutive plasmid, with csg operon and ampicillin resistance Engineered by us during this project
pFM_neg_Ctrl Constitutive plasmid, without csgA and ampicillin resistance Engineered by us during this project
PN2_013 Plasmid used as a template for our engineered plasmid pFM_RB Given to us by Roberto Avendaño Vega, Schaerli Lab
pFM_RB Plasmid that encode for the SpyCatcher protein, due to the presence of the als3 gene Given to us by Roberto Avendaño Vega, Schaerli Lab
pFM_tag Plasmid that encode for the SpyTag protein Given to us by Roberto Avendaño Vega, Schaerli Lab
pKD13 Plasmid for gene deletion contained the FRT regions flanking a kanamycin resistance cassette that was then inserted into the genome in place of our operons Given to us by Schaerli Lab
pDK46 Plasmid for gene deletion contained the red recombinase genes that allowed recombination between our resistance cassette and the csg operon Given to us by Schaerli Lab
pCP20 Plasmid for gene deletion encoding for the flippase enzyme that removed our resistance cassette via recombineering of the FRT regions Given to us by Schaerli Lab


Strains

Name of the Strains Characteristics Reference or source
E. coli NEB5α Used for cloning Schearli Lab
E. coli PB_002 Used to test our plasmid, strain without csg operons Created during this project
E. coli MG1655 Used for the gene deletion project Schearli Lab
E. coli M037 Used as a control strain Schearli Lab