Our contribution
Our contribution for future iGEM teams is to have generated and making freely available an E. coli strain with the deletion of the two csg operons (named PB_002). In addition, we provide the protocol (see section Experiments) and the sequences of the primers, that you can find at the end of the page, used to generate this strain. This can be used if another team would like to introduce the deletion in their favorite E. coli strain.
The Curli fibers are the main protein component of E. coli biofilm. Two separate operons (csgBAC and csgDEFG) produce seven proteins (CsgA, CsgB, CsgC, CsgD, CsgE, CsgF, and CsgG) to form the Curli fibers. CsgA is the major Curli subunit forming the extracellular fibers. However, to successfully form the fibers, CsgB, CsgC, CsgE, CsgF, and CsgG are also required. CsgD is the master regulator of biofilm formation.
The goal of our project is to capture microplastics by overexpressing Curli fibers. We worked with a plasmid coding for all six important csg genes. This allowed us to be independent of the regulation and expression from the V genes from the genome. To prove that all the Curli production comes from our plasmid, we deleted the csg operons from the genome.
This strain can be useful for all teams that want to test the biofilm formation of their plasmids without having the problem of interference from the csg genes in the genome. By doing so, they will be sure that any production of Curli fibers is due to their engineered plasmid.
To obtain the deletion of the csg operons from strain MG1655, we used the lambda red recombination genetic engineering method, which allows the precise deletion or insertion of sequences within the DNA. This approach involves the use of an antibiotic resistance cassette with homologous regions of the csg operons at the ends, which by recombination will replace the csg operon. The lambda red recombination technique (see section Experiments) is based on the use of Red genes (Red Exo, Red Beta, Red Gam), that enable the recombination of target DNA into the bacterial genome.
First, we amplified the resistance cassette and FRT regions, adding homologous regions to the genome at the ends using primers. We then transformed the plasmid containing the red genes into strain MG1655. The next step was the recombination, which took place after the insertion of the fragment with the resistance cassette into strain MG1655 with the plasmid with the Red genes. To verify that the resistance cassette had been inserted, we did a colony PCR and first verified on a gel electrophoresis the size of the PCR product and then with sequencing to check the correctness of sequence.
Once we had verified that the insertion of the resistance cassette was correct, we had to proceed with its removal from the genome. To do this, we transformed a plasmid containing the flippase gene into this new resistance strain, PB_001. The flippase through the FRT sites allowed the removal of the resistance cassette and we thus obtained our strain with the deletion of the csg operon PB_002.
The last step was to test the inability of our strain PB_002 to produce a biofilm.
To this end, we cultured the cells with the genetic deletion on plates containing Congo red.
The results clearly showed that our strain did not develop a biofilm, as uptake of Congo red did not occur (Figure 2).
→ Read more: Results
red and Coomassie blue (to improve contrast).
A) A Colony of strain M037, a strain not capable of biofilm formation, used as control.
B) Colony of our deletion strain MG1655 deltaCsg (PB_002).
C) A Colony of strain M037 complemented with a plasmid encoding for the csg operons, used as positive control.
Our PB_002 strain did not update the Congo red, hence did not form any Curli fibers.
Conclusion
In conclusion, we contribute to the iGEM community by making our strain PB_002 with the deletion of the csg operon and the primers we used for the amplification of the resistance cassette and for sequencing available to anyone who needs it.
Table with primers
| Primer name | Sequence | Description |
|---|---|---|
| PR_496 | tttcgcttaaacagtaaaatgccggatgataattccggcttttttatctggtgtaggctggagctgcttc | Forward primer to amplify the kanamycin resistance cassette and to add the homologous region to the genome |
| PR_497 | gcagcagaccattctctccagattcatcttatgctcgatatttcaacaaaattccggggatccgtcgacc | Reverse primer to amplify the kanamycin resistance cassette and to add the homologous region to the genome |
| PR_500 | caccgtgagcaggaaatca | Forward sequencing primer to verify the insertion of the kanamycin resistance cassette in the genome |
| PR_501 | aggtctgaacatttattctatttcc | Reverse sequencing primer to verify the insertion of the kanamycin resistance cassette in the genome |
Genome Sequence
For the sequence of the genome of our strain PB_002, see the link below:
BBa_K4685044Protocol Gene Deletion
This is the protocol that we used to created our strain PB_002 with the deletion of the csg operons.