Wet Lab Results
Results of System 1（ferrichrome）
In System One, our objective is to enhance the expression of ferrichrome. This enhancement facilitates the binding of anti-GAD within the brain to ferrichrome, consequently reducing the levels of anti-GAD expression in the patient's cerebral system.
We choose Lactobacillus Plantarum L168 as the chassis and pSIP403 as the vector, and search its synthetic pathway and find the key enzyme N-acyltransferase. Then, we inserted the genes of N-acyltransferase into our designed plasmids to complete the construction and synthesis of plasmids.
The DNA Level
Lactobacillus Plantarum L168, a strain we obtained from our PI, Xingyin Liu's lab, has been proven to be able to alleviate social behavior deficits in animal models of autism.
We constructed the pSIP403-N-acyltransferase-PnisA-nisRK-erY, transformed it into Lactobacillus Plantarum L168, and extracted the plasmid to prove the success of our transformation.
Initially, we employed a double enzyme digestion approach with AgeI and ApaLI to facilitate the homologous recombination of plasmids. The vector utilized in this process was pSIP403. For homologous recombination, we strategically designed primers and conducted PCR using the homology arm located on the plasmid backbone.
| Primer | Sequence |
|---|---|
| GJ-F | cgccaagcttcaaattacag |
| GJ-R | ctcaccaacaacctatcttaacg |
| LT-F | taagataggttgttggtgagTGTTGCCTAACCCAACGATC |
| LT-R | ctgtaatttgaagcttggcgCTTGTGATTTCCGGAACGAG |
Then we transformed it into E.coli DH5α. To confirm the efficacy of our transformation, we devised primers, conducted plasmid PCR and colony PCR, and subsequently analyzed the results via agarose gel electrophoresis.
sFunction Verification
We achieved successful plasmid transformation into L168, and the validation through PCR and agarose gel electrophoresis confirmed the success of this process. Subsequently, we cultured L168 and performed RNA extraction. Bacteriophage was utilized for RNA extraction, while the supernatant was employed for metabolite measurement.
Subsequently, reverse transcription and quantitative polymerase chain reaction (qPCR) experiments were conducted to quantify the gene expression levels of both L168 and ferrichrome plasmids.
As shown in the figure, these are our qPCR results.
The leftmost group represents the baseline L168 in its normal state, serving as the control group. The middle group corresponds to the introduction of the pSIP403-N-acyltransferase-PnisA-nisRK-erY plasmid from System 1 into L168, designed to express ferrichrome. The rightmost group involves the incorporation of the pSIP403-hemA-PnisA-nisRK-erY plasmid from System 2 into L168, designed for the expression of protoporphyrin.
Figure 1. Relative Expression Analysis of Gene ferrichrome by qPCR.
This experiment analyzed the relative expression levels of Gene ferrichrome using qPCR. The figure illustrates that the relative expression of Gene ferrichrome was significantly upregulated in pSIP403-N-acyltransferase-PnisA-nisRK-erY plasmid in L168(L168-LT) compared to the single L168(L168) (p < 0.0001).
The qPCR results elucidate that our designed plasmid effectively and significantly upregulated the gene expression of ferrichrome in L168.
csv download
You can download the csv by clicking "Download"Results of System (protoporphyrin)
For anti-MBP, we selected protoporphyrin as the small molecule metabolite for antibody degradation. During our investigation, we identified the rate-limiting enzyme, glutamyl-tRNA reductase, within the synthetic pathway. Subsequently, we utilized the UniProt database to identify its corresponding gene in Lactobacillus plantarum L168, leading us to decide on overexpressing this gene.
We identified the gene sequence hemA, encoding the key enzyme glutamyl-tRNA reductase, and designed both upstream and downstream primers for hemA. The selected vector for this purpose was pSIP403. Subsequently, we designed the pSIP403-hemA-PnisA-nisRK-erY plasmid and introduced it into the sensory Lactobacillus plantarum L168. As an additional safety measure, we incorporated a suicide switch that could be activated by a transferable nisin-controlled expression (NICE) system, utilizing the combination of the nisA promoter and nisRK regulatory genes.
The DNA Level
We generated the pSIP403-hemA-PnisA-nisRK-erY plasmid, subsequently performing its transformation into Lactobacillus Plantarum L168 and conducting plasmid extraction to confirm the successful transformation.
In the initial step, we employed BgIII and BanII for double enzyme digestion, facilitating the homologous recombination of plasmids. The vector of choice in our study was PSIP403, and we meticulously designed primers to enable homologous recombination through PCR, utilizing the homology arm located on the plasmid backbone.
| Primer | Sequence |
|---|---|
| GJ-F | cgccaagcttcaaattacag |
| GJ-R | ctcaccaacaacctatcttaacg |
| HY22f | gtggcaagttcatccgtatcaag |
| HY22r | actggtattgttcctacgtcgag |
| YBL-F | taagataggttgttggtgaggactctagaagatctttgacagc |
| YBL-R | ctgtaatttgaagcttggcggattacgaattcgagctcgg |
we transformed it into E.coli DH5α. To confirm the successful outcome of our transformation, we designed primers, conducted both plasmid PCR and colony PCR, and subsequently subjected the resulting products to agarose gel electrophoresis.
Function Verification
We successfully transformed the plasmid into L168, and validation through PCR and agarose gel electrophoresis yielded successful results.
Sequencing of the bacteria after transformation into L168 confirmed the successful plasmid transfer.
Afterwards, we cultured L168 bacteria and extracted its RNA. The bacteriophage was used for RNA extraction and the supernatant was used for metabolite measurement.
Subsequently, reverse transcription and quantitative polymerase chain reaction (qPCR) experiments were conducted to quantify the gene expression levels of both L168 and protoporphyrin plasmids.
As shown in the figure, these are our qPCR results.
The leftmost group(L168) represents the baseline L168 in its normal state, serving as the control group. The middle group(L168-LT) corresponds to the introduction of thepSIP403-N-acyltransferase-PnisA-nisRK-erY plasmid from System 1 into L168, designed to express ferrichrome. The rightmost group(L168-YBL) involves the incorporation of the pSIP403-hemA-PnisA-nisRK-erY plasmid from System 2 into L168, designed for the expression of protoporphyrin.
Figure 3. Relative Expression Analysis of Gene protoporphyrin by qPCR.
This experiment analyzed the relative expression levels of Gene protoporphyrin using qPCR. The figure illustrates that the relative expression of Gene protoporphyrin was significantly upregulated in pSIP403-hemA-PnisA-nisRK-erY plasmid in L168(L168-YBL) compared to the single L168(L168) (p < 0.0001).
The qPCR results elucidate that our designed plasmid effectively and significantly upregulated the gene expression of protoporphyrin in L168.
The attached annex comprises the original data obtained from our qPCR experiments.
