Materials & Equipments

Plasmidic vectors

Plasmid Relevant characteristics
009-NAMPT NAMPT fragment
Pcdh-CMV-T7-NAMPT Point mutation verification


Primers

Pairs name 5' to 3' primer sequence Purpose
NAMPT-F gagctagcgaattatgaatcctgcggca NAMPT fragment cloning
NAMPT-R tgcggccgcggactaatgatgtgctg NAMPT fragment cloning
Nampt-N10D-F gagttcgacatcctcctggccac site directed mutagenesis for NAMPT N10D
Nampt-N10D-R caggaggatgtcgaactcggcttctg site directed mutagenesis for NAMPT N10D
Nampt-K77N-F gtagtaaccaatgagaaaatccaggaagccaaag site directed mutagenesis for NAMPT K77N
Nampt-K77N-R gcttcctggattttctcattggttactactttacc site directed mutagenesis for NAMPT K77N
Nampt-K84Q-F gaagcccaagatgtctacaaagaacatttccaag site directed mutagenesis for NAMPT K84Q
Nampt-K84Q-R ctttgtagacatcttgggcttcctgga site directed mutagenesis for NAMPT K84Q
Nampt-I114V-F catcttccagtagaaataaaagctgttcctgagg site directed mutagenesis for NAMPT I114V
Nampt-I114V-R gaacagcttttatttctactggaagatgcccatc site directed mutagenesis for NAMPT I114V
NAMPT-V221G-F ggaacagatacaggagcaggacttgctct site directed mutagenesis for NAMPT V221G
NAMPT-V221G-R gcaagtcctgctcctgtatctgttcctttg site directed mutagenesis for NAMPT V221G
bN-V221A-F ggaacagatacagcagcaggacttgctct site directed mutagenesis for NAMPT V221A
bNAMPT-V221A-R gcaagtcctgctgctgtatctgttcctttg site directed mutagenesis for NAMPT V221A
NAMPT-Y240S-F gttccaggctcttctgttccagcagc site directed mutagenesis for NAMPT Y240S
NAMPT-Y240S-R ggaacagaagagcctggaacaggatct site directed mutagenesis for NAMPT Y240S
dN-D279L-F ctgtggtcagccttagctatgacatttataatgcg site directed mutagenesis for NAMPT D279L
dN-D279L-R tgtcatagctaaggctgaccacagatacagg site directed mutagenesis for NAMPT D279L
eNa-D313N-F cagacctaattctggaaaccctcttgac site directed mutagenesis for NAMPT D313N
eNa-D313N-R gggtttccagaattaggtctgattattagtgg site directed mutagenesis for NAMPT D313N
eN-D354E-F caaggggaaggagtagatattaataccttacaagag site directed mutagenesis for NAMPT D354E
eN-D354E-R gtaaggtattaatatctactccttccccttgaataactc site directed mutagenesis for NAMPT D354E
cN-G384C-F ccttcggttctggttgtggtttgctacagaag site directed mutagenesis for NAMPT G384C
cN-G384C-R gcaaaccacaaccagaaccgaaggcaata site directed mutagenesis for NAMPT G384C
cN-G384S-F gccttcggttctggttccggtttgctacagaagttg site directed mutagenesis for NAMPT G384S
cN-G384S-R ctgtagcaaaccggaaccagaaccgaaggcaata site directed mutagenesis for NAMPT G384S
bN-L386P-F ggtggaggtccgctacagaagttgacaagag site directed mutagenesis for NAMPT L386P
bNAMPT-L386P-R cttctgtagcggacctccaccagaaccgaaggc site directed mutagenesis for NAMPT L386P
eN-D393E-F gacaagagaactcttgaattgttccttcaag site directed mutagenesis for NAMPT D393E
eN-D393E-R ggaacaattcaagagttctcttgtcaacttctg site directed mutagenesis for NAMPT D393E


Reagents

  1. KOD One™ PCR Master Mix (enzyme)
    • KOD One™ PCR Master Mix is a PCR master mix based on genetically modified KOD DNA polymerase (UKOD).
    • Advantages:
      • Enables fast PCR, which has an extension time of 5 sec/kb by applying UKOD and a new Elongation Accelerator.
      • Provides greater efficiency and elongation capabilities than conventional PCR enzymes.
  2. dNTPs (Deoxyribonucleotide metabolites)
    • dNTPs are substrates for DNA synthesis. It has been suggested that their availability affects cell cycle progression in pathological situations such as development and tumour growth.
  3. PCR Grade Water
    • PCR-grade Water is intended for use in molecular biology applications including PCR and RT-PCR.
    • The ultra-pure and sterile filtered water is manufactured free of detectable inhibitors, contaminants or enzymatic activity.
    • PCR Grade is specially purified, double-distilled, deionized, and autoclaved.
  4. 10X cut buffer
    • The reaction buffer is a 10-fold concentrate that contains Tris-HCl, pH 8.0, sodium chloride, magnesium chloride and protein stabilizers.
    • Used for polyacrylamide and agarose gel electrophoresis. This product is optimized for use in DNA applications.
  5. Taq DNA Polymerase
    • PCR is based on using the ability of DNA polymerase to synthesize new strands of DNA complementary to the offered template strand.
    • Taq polymerase can work at high temperatures with high efficiency and amplification capacity, which other bodily enzymes cannot.
  6. Magnesium Chloride
    • Acting as a cofactor, it enhances the enzymatic activity of DNA polymerase, thereby boosting DNA amplification.
  7. Invitrogen Random Primers (F/R)
    • A standard PCR uses two primers, often called the“forward”and “reverse”primers.
    • Are oriented on opposite strands of the DNA. During a PCR run, the primers will bind to the DNA, bookending the sequence you wish to amplify.
  8. Agarose
    • Nucleic acid fragments are separated by their length while moving through an agarose matrix. By adding a dye or an intercalating agent like ethidium bromide (EtBr), these fragments can be visualized under ultraviolet light.
  9. Flashcut™ Dpnl
    • A series of restriction endonucleases that have undergone genetic engineering recombination and can accurately cut DNA within 5-15 minutes
    • Suitable for fast digestion of plasmid DNA, PCR products, genomic DNA, etc.
    • Has a common enzyme digestion buffer that greatly simplified the enzyme digestion reaction system.
  10. Trans5α Chemically Competent Cell
    • Specifically designed for the chemical transformation of DNA. It permits a transformation efficiency of over 108 cfu/μg DNA.
    • Features:
      • High transformation efficiency: >108 cfu/μg (pUC19 DNA).
      • Reduced recombination of cloned DNA.
      • Blue/white selection.



Equipments

  1. Centrifuge
    • A series of restriction endonucleases that have undergone genetic engineering recombination and can accurately cut DNA within 5-15 minutes.
  2. Pipette Guns
    • Allow us to rapidly draw and disperse liquids at accurate volumes.
  3. Applied Biosystems PCR Thermal Cycler 9700
    • A technology used for quick and easy amplifying DNA sequences, which is based on the principle of enzymatic replication of the nucleic acids.
  4. TIANprep Rapid Mini Plasmid Kit
    • The TIANprep Rapid Mini Plasmid Kit is optimised from traditional alkaline lysis technology, by which high-quality plasmid DNA can be purified within 8 minutes.
    • The new lysis buffer allows the adsorption of DNA onto the silica membrane in the presence of high salt.
  5. Thermo Scientific™ NanoDrop™ 2000/2000c Spectrophotometers
    • Allows direct pipetting of samples onto the optical measurement surface. When the measurement is complete, simply wipe the surface with a lint-free lab wipe. The NanoDrop 2000c integrates a sample retention system with cuvette functionality.
    • DNA concentration can be determined by measuring the absorbance at 260 nm in a spectrophotometer using a quartz cuvette. For maximum accuracy, the reading should be between 0.1 and 1.0.
  6. Electrophoresis instrument
    • A technique used to separate DNA fragments according to their size.
    • DNA samples are loaded into wells (indentations) at one end of a gel, and an electric current is applied to pull them through the gel.
    • DNA fragments are negatively charged, so they move towards the positive electrode.
  7. Gel Imager
    • It used in molecular biology labs for imaging and documentation of protein suspended within polyacrylamide or agarose gels and nucleic acid.
    • The porous gel is used in this technique acting as a molecular sieve that separates bigger molecules from the smaller ones. As smaller molecules move faster through the gel, larger molecules are left behind.
  8. Biological safety cabinets
    • It used to protect personnel, specimens and the environment whrn handing experiment samples with infectious hazards.
  9. Other equipment
    • Microwave oven;
    • Precision electronic balance;
    • 37 degrees Celsius constant temperature incubator;
    • Refrigerator;
    • Orbital Shaker;
    • Heating block.



Reference

  • Zhu X, Liu H, Chen L, et al. Addressing the Enzyme-independent tumor-promoting function of NAMPT via PROTAC-mediated degradation. Cell Chem Biol. 2022;29(11):1616-1629.e12. doi:10.1016/j.chembiol.2022.10.007