Experiments
During the experimental phase, all the protocols of our experiments were placed in the Protocol section. In addition, all the primers for our sequencing and PCR reactions were recorded in the table below.
Table 1. Condition Controlling System Promoters
| Name | Use | Sequence |
|---|---|---|
| Puc19-luc-F | Sequencing detection of pUC19-LUC plasmid insertion sequence (promotor & Protein coding region) | CCGGCTCCGTTCTACC |
| Puc19-luc-R | Sequencing detection of pUC19-LUC plasmid insertion sequence (promotor) | GGTACGGTGCGGCA |
| M13 rwd | Sequencing detection of pUC19-LUC plasmid insertion sequence (Protein coding region) | GTAAAACGACGGCCAGT |
| pACYC177-T7-EGFP-F | Sequencing detection of pACYC177-T7-EGFP-F plasmid insertion sequence | CCGACGGTGATATGGGG |
| pACYC177-T7-EGFP-R | Sequencing detection of pACYC177-T7-EGFP-F plasmid insertion sequence | TCGGCCCTCATTCGTG |
| CDD-iRGD-R | Adding enzyme cleavage site connectors to CDD-iRGD | GGGTCTAGAGGTACCTTACGCCACATTCAC |
| CDD-iRGD-F | Adding enzyme cleavage site connectors to CDD-iRGD | CCCGAATTCGCGCG |
| A1/LldR-F | Adding enzyme cleavage site connectors to Trigger All and LldR | cccGCTCTTCaagcgaattggccctaccaattcttc |
| A1-R | Adding enzyme cleavage site connectors to Trigger All | cccAAGCTTctcgagtgccacctga |
| LldR-R | Adding enzyme cleavage site connectors to LldR | cccAAGCTTaagtggcactgccaat |
| pCadc-F | Adding enzyme cleavage site connectors to pCadc | cccGCTCTTCaagcgataatatgtaaataaacccatctatagatgg |
| pCadc-R | Adding enzyme cleavage site connectors to pCadc | cccAAGCTTaatagaaactcattcgaaaaggg |
| pPept-F | Adding enzyme cleavage site connectors to pPept-F | cccAAGCTTaatagaaactcattcgaaaaggg |
| pPept-R | Adding enzyme cleavage site connectors to pPept-R | cccAAGCTTgtagtcaccctcactttttgt |