The CsgA-AG4 (BBa_K4968008) fusion protein is used to construct the independent curli nanofibers with the ability to adsorb silver ions. Figure 1 shows the 3D structure of the CsgA-AG4 fusion protein. The main structure of the CsgA (BBa_K4968004) is β sheet, which is regarded as the amyloid feature.
Figure 1: From the figure, the fusion protein has many β sheets, which belong to amyloid. The part of the protein that sticks out is AG4. Outside the outer membrane, the CsgA-AG4 will self-assembly.
To construct a curly fiber device capable of adsorbing noble metal silver ions, we designed a CsgA-AG4 fusion protein. Utilizing the property of CsgA to self-assemble into independent curly fibers in vitro, a CsgA-AG4 fusion protein curly fiber membrane was constructed.
CsgA has been shown to bind to small proteins such as mussel foot proteins (Mfps), helping to maintain their function and facilitate extracellular secretion (Zhong et al., 2014). Therefore, we aim to combine CsgA (BBa_K4968004) and AG4 (BBa_K4968005) proteins to construct an independent nanofiber that can absorb silver ions in wastewater.
According to Evans et.al (2015), CsgC (BBa_K1583001) is involved in preventing the premature polymerization of curli subunits, ensuring that the assembly occurs outside the bacterial cell where it's intended. This chaperone-like protein binds to curli subunits and prevents their aggregation within the cell, enabling controlled and organized assembly once they are transported outside (Taylor et al., 2016). CsgD (BBa_K805015) functions as a master regulator that orchestrates the expression of the genes necessary for curli fiber assembly (Sokaribo et al., 2020). Figure 2 shows the 3D structure of the CsgC and CsgD.
Figure 2: This picture shows the 3D structure of the CsgC (A) and CsgD (B). The picture A and B indicates that the main structure of the CsgC is β sheet. The main structure of the CsgD is α helix and β sheet. The function of CsgC and CsgD is to help the fusion protein CsgA-AG4 expression and secretion.
Figure 3: This picture shows the function of CsgC and CsgD. CsgC is used to help the fusion protein secret. CsgD is used to help the fusion protein’s gene expression.
CsgE and CsgF are thought to play important chaperone functions in the assembly of CsgA into curli (Green et al., 2016). CsgG is an oligomeric lipoprotein located in the outer membrane, responsible for stabilizing and exporting the major subunit CsgA and the minor subunit CsgB to the cell surface (Nenninger et al., 2009). Figure 4 shows the 3D structure of the CsgE, CsgF, and CsgG.
Figure 4: This picture shows the 3D structure of the CsgE (A), CsgF (B) and CsgG (C). The function of CsgE, CsgF, and CsgG is to help the fusion protein secretion and self-assembly extracellularly.
Since the functions of CsgE, CsgF, and CsgG are similar and these three genes are knocked out in the genome of the JF1 strain, we used CsgE-CsgF-CsgG (BBa_K4968010) as a complex component on the plasmid.
This composite part consists of CsgA-AG4 (BBa_K4968008), CsgC-CsgD (BBa_K4968009), CsgE-CsgF-CsgG (BBa_K4968010).
The whole composite part CsgA-AG4-CsgC-CsgD-CsgE-CsgF-CsgG (BBa_K4968011) for JF1 strain whose entire curli operon has been knocked out:
Since the JF1 strain knocks out the entire curli operon, we designed complex components to ensure normal expression of the CsgA-AG4 fusion protein.
Figure 5: This picture indicates the whole process of the fusion protein expression, secretion, and self-assembly in the JF1 strain.
To obtain the vector (CBM-sfGFP-PUC-SUMO), we designed a primer pair, Primer F (GCACCAGGTTGTCGTGTAGACT) and Primer R (AGATCCTGATCCAGAGCCGC). These primers were used to amplify the Vector fragment (CBM-sfGFP-PUC-SUMO) from the PUC-SUMO-SmtA-CBM-sfGFP plasmid via PCR. This Vector fragment serves as the vector component for seamless Gibson assembly, allowing it to be combined with the Insert fragment. It encompasses the CBM, sfGFP, and SUMO tags.
SmtA-CBM-sfGFP (BBa_K4968018) is a multifunctional protein complex designed for bioremediation and protein research. It combines three key components: SmtA (BBa_K4968001), a metallothionein; CBM (BBa_K4968002), a Carbohydrate-Binding Module; and sfGFP (BBa_K4968003), a superfolder Green Fluorescent Protein.
SmtA (BBa_K4968001), derived from cyanobacteria, has the unique ability to bind heavy metal ions (e.g., cadmium, lead, copper). This feature enables it to regulate metal ion levels and protect cells from metal toxicity.
CBM (BBa_K4968002) facilitates strong attachment of SmtA to cellulose, making it an effective bioadsorbent for heavy metal removal. It also offers versatility in modifying cellulose surfaces for various applications.
sfGFP (BBa_K4968003) is a stable and versatile fluorescent marker. Its use alongside other proteins does not induce misfolding, making it ideal for monitoring processes, studying protein dynamics, and protein-protein interaction studies.
The integration of SmtA, CBM, and sfGFP in SmtA-CBM-sfGFP provides a versatile and powerful tool for bioremediation and protein research, allowing precise metal binding, cellulose attachment, and real-time monitoring.
The SUMO-SmtA-CBM-sfGFP composite component is a multifunctional fusion protein designed for diverse applications in molecular research and biotechnology.
SUMO (BBa_K4968007) acts as a molecular chaperone, when SUMO is fused to the N-terminus of the target protein, it can improve the folding of the target protein, enhance its solubility, and increase protein yield.
SmtA (BBa_K4968001) (Cyanobacterial Metallothionein), a member of the metallothionein family, exhibits a unique ability to sense and bind heavy metal ions such as cadmium, lead, and copper. This property aids in regulating cellular metal tolerance and detoxification. Incorporating SmtA into the composite component empowers it with metal-binding functionality, making it an essential element for studies related to metal toxicity and detoxification.
CBM (BBa_K4968002) (Carbohydrate-binding modules) are enzyme components renowned for their specific carbohydrate recognition. The inclusion of CBM in the composite component facilitates selective carbohydrate binding, a valuable feature for protein immobilization and enhanced stability on surfaces.
sfGFP (BBa_K4968003), engineered to prevent misfolding when fused with other proteins, serves as an invaluable tool for tracking and visualizing proteins through green fluorescence while preserving their structural integrity.
In summary, the SUMO-SmtA-CBM-sfGFP composite component is a powerful and adaptable tool that caters to a wide array of research needs. It effectively combines the advantages of each module to support a range of applications in biochemistry, cell biology, and biotechnology.
The MSmtA4-CBM-sfGFP fusion component represents a versatile and biocompatible unit suitable for a wide range of applications.
MSmtA4 (BBa_K4968000) is a variant of the metallothionein SmtA and exhibits a strong affinity for heavy metals such as cadmium, lead, and copper. Therefore, we chose to mutate Arg 26, Lys 8, and Lys 22 to Cys, giving it a larger accessible surface area (ASA) and smaller root mean square fluctuation (RMSF) to enhance the ability of the adsorption of heavy metal ions.
CBM (BBa_K4968002), Carbohydrate-binding modules are integral components of various enzymes that specifically target carbohydrates. CBM can recognize and selectively bind to features on the crystal surface, thereby offering the potential to alter and enhance cellulose properties. CBM exhibits a strong affinity for crystalline cellulose, and introducing it to the cellulose surface for modification can provide robust non-covalent modifications, increasing the redispersibility of functionalized cellulose nanocrystals and improving suspension stability (Aïssa et al., 2019).
sfGFP (BBa_K4968003), a stable and associated fluorescence marker, plays a pivotal role in diverse biological research endeavors. When fused, sfGFP ensures proper protein folding and emits vibrant green fluorescence, thus preventing erroneous protein conformations during expression.
Figure 6: This figure explains the procedure after expressing the fusion protein. The process of adsorbing heavy metal ions.
This fusion module offers unparalleled flexibility, adaptability, and utility across a spectrum of applications, including but not limited to heavy metal adsorption, eco-friendly materials, and advancements in biological research.
SUMO-MSmtA4-CBM-sfGFP is a versatile fusion protein that combines several functional elements to enhance protein expression, stability, heavy metal adsorption, and applications in biological research. This fusion protein comprises a SUMO (BBa_K4968021) tag, a modified metallothionein (MSmtA4)(BBa_K4968000), a carbohydrate-binding module (CBM)(BBa_K4968002), and a superfolder Green Fluorescent Protein (sfGFP)(BBa_K4968003).
The Small Ubiquitin-like Modifier (SUMO (BBa_K4968021)) serves as a fusion tag and molecular chaperone. It enhances protein expression by improving folding, solubility, and yield. SUMO tags are efficiently removed by specific proteases during purification, leaving no residual amino acids.
MSmtA4 (BBa_K4968000), a derivative of Cyanobacterial metallothionein SmtA, is a specialized variant designed to excel in capturing and chelating heavy metal ions in close proximity to its surface. This variant exhibits a strong affinity for a range of heavy metals, including cadmium, lead, copper, and more. To enhance its heavy metal-binding capabilities, strategic mutations were introduced at particular amino acid positions, converting Arg 26, Lys 8, and Lys 22 into cysteine residues. This genetic alteration serves to expand the protein's accessible surface area (ASA) while diminishing the root mean square fluctuation (RMSF), resulting in an increased capacity to effectively capture heavy metal ions.
CBM (BBa_K4968002) are enzymes that can specifically bind to carbohydrates. In this context, they can modify cellulose surfaces, improving the redispersibility and stability of cellulose nanocrystals. This allows the protein to be firmly bound to cellulose-based materials, making it suitable for a wide range of applications.
sfGFP (BBa_K4968003), Superfolder Green Fluorescent Protein ensures proper folding of fusion proteins. It is highly stable and resistant to denaturation, making it a reliable tag for various biological research applications, particularly in studying protein interactions, localization, and expression.
SUMO-MSmtA4-CBM-sfGFP fusion protein combines the unique strengths of each component to provide a powerful and flexible tool in biological research, heavy metal remediation, and cellulose-based materials development.
| Type | Part Number | Name | Length | Description |
|---|---|---|---|---|
| Composite | CsgA-AG4 | 510 bp | This composite part combines Optimized CsgA (BBa_K4968004) and AG4 (BBa_K4968005), containing a 6 amino acid linker. | |
| Composite | CsgC-CsgD | 1022 bp | This composite part combines CsgC (BBa_K1583001) and CsgD (BBa_K805015), containing a 38 bp nonsense sequence. | |
| Composite | CsgE-CsgF-CsgG | 1717 bp | This composite part combines CsgE (BBa_K4161013), CsgF (BBa_K4161014), and CsgG (BBa_K4161015), containing two 38 bp nonsense sequences. | |
| Composite | CsgA-Ag4-CsgC-CsgD-CsgE-CsgF-CsgG | 3293 bp | This composite part combines CsgA-AG4 (BBa_49680008), CsgC-CsgD (BBa_K4968009), and CsgE-CsgF-CsgG (BBa_K4968010), containing two 38 bp nonsense sequences. | |
| Composite | CBM-sfGFP-pUC_GW_Kan R-SUMO | 3991 bp | This composite part combines CBM (BBa_49680002), sfGFP (BBa_49680003), pUC_GW_Kan R (BBa_49680012), and SUMO (BBa_49680007). As a Vector for Gibson assembly with MSmtA4 (BBa_K4968000). | |
| Composite | SmtA-CBM-sfGFP | 1242 bp | This composite part combines SmtA (BBa_K4968001), CBM (BBa_K4968002), and sfGFP (BBa_K4968003), containing two 8 amino acid flexible linker. | |
| Composite | SUMO-SmtA-CBM-sfGFP | 1554 bp | This composite part combines SmtA (BBa_K4968001), CBM (BBa_K4968002), sfGFP (BBa_K4968003), and SUMO (BBa_K4968007), containing a 6 amino acid flexible linker and two 8 amino acid flexible linker. | |
| Composite | MSmtA4-CBM-sfGFP | 1242 bp | This composite part combines MSmtA4 (BBa_K4968000), CBM (BBa_K4968002), and sfGFP (BBa_K4968003), containing two 8 amino acid flexible linker. | |
| Composite | SUMO-MSmtA4-CBM-sfGFP | 1554 bp | This composite part combines MSmtA4 (BBa_K4968000), CBM (BBa_K4968002), sfGFP (BBa_K4968003), and SUMO (BBa_K4968007), containing a 6 amino acid flexible linker and two 8 amino acid flexible linker. |
Aïssa, K. et al. (2019) ‘Functionalizing cellulose nanocrystals with click modifiable carbohydrate-binding modules’, Biomacromolecules, 20(8), pp. 3087–3093. doi:10.1021/acs.biomac.9b00646.
Evans, L.M. et al. (2015) ‘The Bacterial Curli System Possesses a Potent and Selective Inhibitor of Amyloid Formation’ Mol Cell, 57(3): 445–455. Available at: https://doi.org/10.1016/j.molcel.2014.12.025
Green, A. et al. (2016) ‘Are the curli proteins CsgE and CsgF intrinsicallydisordered?’ Intrinsically Disord Proteins 4(1): e1130675. Available at: https://doi.org/10.1080/21690707.2015.1130675
Nenninger, A.A., Robinson, L.S. and Hultgren S.J. (2009) ‘Localized and efficient curli nucleatione amyloidrequires the chaperone-likassembly protein CsgF’ BIOLOGICAL SCIENCES 106(3) 900-905. Available at: https://doi.org/10.1073/pnas.0812143106
Sokaribo, A.S. et al. (2020) ‘Metabolic Activation of CsgD in the Regulation of Salmonella Biofilms’ Microorganisms. 8(7):964. Available at: https://doi:10.3390/microorganisms8070964.
Taylor, J.D. et al. (2016) ‘Electrostatically-guided inhibition of Curli amyloid nucleation by the CsgC-like family of chaperones’ Scientific Reports, bind 6, 24656. Available at: https://doi.org/10.1038/srep24656