Claritein is the name of the project, which is the represent that Proteins work as clarifier in dealing with polluted water. The engineering success displays the engineering cycles during our project. The engineering cycles express the Design, Build, Test and Learn. The reflection and summary at the end of each iteration always leads to the beginning of the next iteration, and the whole idea of engineering runs through the project.
Taking inspiration from Courchesne et al.'s research (2017), we adopted a convenient filtration-based method for the purification of nanofibrous materials, allowing us to produce free-standing curli films. AG4, a dodecapeptide, possesses a remarkable affinity for silver ions, while CsgA forms the structural backbone of amyloid protein nanofibers. Our goal was to produce a membrane with both biological activity and the capability to absorb silver ions effectively.
We initiated this process by JF1 bacteria, which had been knocked out all curli-related genes (CsgBAC and CsgDEFG), a strain we borrowed from Professor Zhong's lab. The deletion of these genes necessitated the design of plasmids encoding CsgA, CsgC, CsgD, CsgE, CsgF, and CsgG to regulate the expression of the curli-specific secretory apparatus and CsgA protein, a key component of curli fibers' structure.
Figure 1 outlines the mechanism of curli biogenesis. According to Figure 1, to enable CsgA proteins to detach from the outer membrane, we needed to delete the CsgB gene in the genome. Additionally, Figure 2 elucidates the basic principles for simultaneously knocking out the CsgA and CsgB genes from the genome. Deleting the CsgA gene facilitated the regulation of CsgA-AG4 fusion protein expression in the plasmid, eliminating interference from pure curli fibers without AG4. Moreover, in this gene editing process, all curli fibers were allowed to detach from the outer membrane while gaining an affinity for silver ions.
Figure 1: Curli Biogenesis Mechanism. In this figure, A, B, C, E, F, and G correspond to CsgA, CsgB, CsgC, CsgE, CsgF, and CsgG proteins, respectively. Nter and Cter denote the N-terminal and C-terminal regions of the proteins. CsgA is the primary component of curli, forming the amyloid fibers. CsgB binds to CsgA on the cell surface, while CsgC prevents the formation of pre-amyloid fibers. CsgE, CsgG, and CsgF function as polymerases for secreted proteins (Yan et al., 2020).
Figure 2: Deletion of CsgA and CsgB Genes from the Genome Using Plasmid Transformation. (CsgA, CsgB): The first group indicates that when retaining the genes of CsgA and CsgB, some amyloid proteins will attach to AG4 dodecapeptide, while others will not. All curli fibers will be anchored on the outer membrane. (ΔCsgA, CsgB): The second group indicates that when knocking out the gene of CsgA and retaining CsgB, all amyloid proteins will attach to AG4 dodecapeptide and anchor on the outer membrane. (CsgA, ΔCsgB): The third group indicates that when retaining the gene of CsgA and knocking out CsgB, all curli fibers will detach from the outer membrane. However, some amyloid proteins will attach to AG4 dodecapeptide, while others will not. (ΔCsgA, ΔCsgB): The final group indicates that when deleting both the genes of CsgA and CsgB, all amyloid proteins will link with AG4 dodecapeptide and detach from the outer membrane.
Figure 3 illustrates the use of two promoters to regulate CsgBAC and CsgDEFG in the bacterial genome and use one promoter to regulate CsgA-AG4-CsgC-CsgD-CsgE-CsgF-CsgG in the plasmid. Drawing inspiration from Courchesne et al. (2017), we employed a T7 promoter to govern gene expression by altering transcription direction and removing noncoding sequences between genes. With these considerations in mind, we devised the biological pathway CsgA-AG4-CsgC-CsgD-CsgE-CsgF-CsgG (BBa_K4968011) as a means to control the expression of the curli-specific secretory apparatus in the outer membrane and the fusion protein CsgA-AG4.
Figure 3: Transcriptional Orientation of the Genome and Plasmid. The upper section represents the genome, while the lower section represents the plasmid.
Figure 4 provides a genetic circuit representation of the CsgA-AG4-CsgC-CsgD-CsgE-CsgF-CsgG pathway. Subsequently, we introduced the plasmid pET21d(+)-CsgA-AG4-CsgC-CsgD-CsgE-CsgF-CsgG into the JF1 bacteria strain via electroporation. Induction of protein expression in JF1 was achieved using 0.2mM IPTG. Confirmation of amyloid protein nanofiber structure was subsequently conducted through Congo red staining. Figure 5 showcases the pET21d(+)-CsgA-AG4-CsgCDEFG plasmid design, as generated using SnapGene.
Figure 4: Genetic Circuit for Biosorbent Synthesis of Silver Ion Adsorption. This biological pathway is induced by IPTG. The T7 promoter is selected for the JF1 strain. CsgA and AG4 are linked by a GSGGSG linker. CsgC, CsgD, CsgE, CsgF, and CsgG are transcribed individually.
Figure 5: pET-21d(+)-CsgA-AG4-CsgCDEFG Plasmid Map Created Using SnapGene. This diagram illustrates the CsgA-AG4-CsgCDEFG biological pathway within the pET21d(+) plasmid.
Drawing inspiration from the similarity in Congo red staining mechanisms between amyloid proteins and polysaccharides (Puchtler, Sweat, and Levine, 1962), we hypothesized that Congo red could effectively stain CsgA, an amyloid protein. We utilized IPTG to induce transcription under the T7 promoter, leading to the expression of the CsgA-AG4-CsgC-CsgD-CsgE-CsgF-CsgG protein. To explore the optimal IPTG concentration for inducing protein expression, we established a gradient of IPTG concentrations. Variations in protein expression levels were assessed by measuring the extent of Congo red staining using a microplate reader at a wavelength of 490nm. When amyloid protein was expressed at higher levels, it bound more Congo red, resulting in a clear, colorless supernatant. Conversely, lower amyloid protein expression led to less Congo red binding, resulting in a red supernatant. The OD490 data from the microplate reader indicated the degree of redness in the supernatant. The difference between the OD490 values of the supernatant from bacteria without IPTG induction and the supernatant induced by IPTG reflected the impact of different IPTG concentrations on protein expression while eliminating the influence of polysaccharides on the bacterial cell wall.
Figure 6: This graph depicts the relative protein expression levels of Amyloid-like Curli Fiber Protein produced by the JF1 strain under varying IPTG concentrations. The y-axis illustrates the difference in absorbance values at 490nm between the non-plasmid-transformed JF1 strain subjected to the Congo Red assay and the plasmid-transformed JF1 strain induced with different IPTG concentrations, reflecting the relative curli fiber protein expression level. The x-axis displays the gradient of IPTG concentrations ranging from 0mM to 1.5mM. These data provide insights into how IPTG concentration affects the protein expression of Amyloid-like Curli Fiber Protein in JF1.
Figure 7: This graph illustrates the impact of varying IPTG concentrations on the expression of Amyloid-like Curli Fiber Protein by the JF1 strain. The y-axis represents the difference in absorbance values at 490nm between the plasmid-transformed JF1 strain uninduced by IPTG and the same strain induced with IPTG concentrations ranging from 1mM to 1.5mM. This difference in absorbance values highlights the modulation of protein expression levels in response to incremental IPTG concentrations. The x-axis represents the IPTG concentration gradient. These results elucidate the role of IPTG in regulating the expression of Amyloid-like Curli Fiber Protein in JF1, offering critical insights into its production dynamics.
Based on the data provided by the experimental results, the optimal IPTG concentration was determined to be 0.2mM. However, even when induced with the optimal IPTG concentration, the production of amyloid protein nanofibers was insufficient to form the desired film.
To reengineer the regulation from CsgBAC and CsgDEFG to CsgA-AG4-CsgC-CsgD-CsgE-CsgF-CsgG, it is likely that the transcription constant may decrease, resulting in significantly lower transcriptional efficiency for CsgA-AG4-CsgDEFG compared to CsgBAC and CsgDEFG, which are regulated by two promoters in opposing directions. This modeling suggests that such an adjustment may lead to reduced protein expression. Furthermore, the presence of multiple regulatory functions within nonsense sequences can introduce complications when deleted arbitrarily.
To mitigate the passive effects of altering the regulation direction and deleting nonsense sequences, we refined the plasmid design. We aimed for a more streamlined biological pathway while preserving the genes responsible for the secretory protein channel in the genome. Simultaneously, we knocked out the CsgB gene, preventing amyloid protein nanofibers (CsgA) from anchoring onto secreted proteins, making their separation via filtration more straightforward. Deleting the CsgA gene on the genome facilitated the regulation of CsgA expression on the plasmid. Because of the high growth rate and protein expression capabilities, we selected the BL21(DE3) strain as our chassis to produce the curli fiber film.
We selected for the pET21a(+) plasmid and designed the biological pathway of CsgA-AG4 (BBa_K4968008). Figure 8 exhibits the genetic circuit of pET21a(+)-CsgA-AG4. Figure 9 presents the pET21a(+)-CsgA-AG4 plasmid map created using SnapGene.
Figure 8: The genetic circuit of the biosorbent synthesis for noble metal ions adsorption. IPTG induces this biological pathway. The T7 promoter is selected for the BL21(DE3) strain. CsgA and AG4 are linked with a GSGGSG linker.
Figure 9: pET-21a(+)-CsgA-AG4 plasmid map created by SnapGene. This graph displays the CsgA-AG4 biological pathway in the pET21d(+) plasmid.
Our advisor, Professor Zhu, has expertise in homologous recombination gene knockout techniques, specifically the Lambda red method. Under his guidance, we were confident in applying the Lambda red method to knock out genes. Consequently, we deleted the CsgB and CsgA genes from the BL21(DE3) genome using Lambda red. The Lambda red method relies on homologous recombination.
Following the approach of Datsenko and Wanner (2000), we designed a homologous fragment named RecomSwapNeo R/Kan R (BBa_K4968006). This fragment includes 51bp homologous segments from both up and downstream of the CsgB and CsgA genes, as well as kanamycin resistance and two FRT fragments, which serve to replace the CsgA and CsgB genes in the genome. You can find detailed information about the gene deletion using Lambda red on the Result. Figure 10 shows the plasmid map of RecomSwapNeo R/Kan R created with SnapGene.
RecomSwapNeo R/Kan R (BBa_K4968006) was amplified using Polymerase Chain Reaction (PCR) and inserted into BL21(DE3) with the assistance of the pKD46 plasmid. The pKD46 plasmid provides the red system enzyme necessary for gene recombination. Successful deletion of the CsgA and CsgB genes was confirmed through agarose gel electrophoresis to determine the length of PCR products. Figure 11 displays the agarose gel electrophoresis results, highlighting bands near 1.5kb, confirming the successful deletion of the CsgA and CsgB genes. Subsequently, we transformed pET21a(+)-CsgA-AG4 into BL21(DE3) (ΔCsgB, ΔCsgA) via electroporation.
Figure 10: pUC57-RecomSwapNeo R/KanR plasmid made by SnapGene. This graph indicates the RecomSwapNeo R/Kan R insert in the Puc57 plasmid.
Figure 11: The agarose gel electrophoresis of the DNA fragment in the genome from BL21(DE3). Sample 1, sample 2, and sample 3 show the strips are 1 kb. Sample 5 has the highlight strip which is near 1.5kb. The length of the highlight strips is the same as the recombinant fragment which is 1528bp. This result means the CsgB and CsgA have been knocked out.
IPTG induces T7 polymerase transcription. To explore the optimal IPTG concentration, we created a series of IPTG concentration gradients to investigate their effect on CsgA-AG4 expression. Different protein expression levels were assessed using Congo red staining and measured with a microplate reader at 490nm.
As in the case of JF1 bacteria, we compared the IPTG-induced colonies with those lacking plasmid introduction and those without IPTG induction. Differences in the expression of various reactive proteins were detected by the change in OD490. Figure 12 presents the predicted model of CsgA-AG4 mRNA by Matlab R2022b, while Figures 13 and 14 display the experimental results.
Figure 12: The graph of the projected result of relative protein expression levels of mRNA of Amyloid-like Curli Fiber Protein under different IPTG concentrations using the T7 promoter. While the IPTG concentration is 200μM, the mRNA increased sharply. When IPTG concentration is above 600μM, mRNA production does not increase basically.
Figure 13: The graph illustrates the relative protein expression levels of Amyloid-like Curli Fiber Protein produced by the BL21(DE3) strain under different IPTG concentrations. The y-axis represents the discrepancy in absorbance values at 490nm between the non-plasmid-transformed BL21(DE3) strain subjected to Congo Red assay and the plasmid-transformed BL21(DE3) strain induced with various IPTG concentrations to show the relative curli fiber protein expression level. The gradient of IPTG concentrations ranges from 0mM to 1.5mM along the x-axis. The depicted data provide insight into the impact of IPTG concentration on the protein expression of Amyloid-like Curli Fiber Protein in BL21(DE3), aiding in the understanding of its protein expression level.
Figure 14: The graph portrays the influence of varying IPTG concentrations on the expression of Amyloid-like Curli Fiber Protein by the BL21(DE3) strain. The y-axis delineates the disparity in absorbance values at 490nm between the plasmid-transformed BL21(DE3) strain, which remained uninduced by IPTG, and the same strain induced with a gradient of IPTG concentrations ranging from 1mM to 1.5mM. This difference in absorbance values captures the modulation of protein expression levels in response to incremental IPTG concentrations. The x-axis represents the IPTG concentration gradient. These results elucidate the role of IPTG in regulating the expression of Amyloid-like Curli Fiber Protein in BL21(DE3), providing critical insights into its production dynamics.
The data from Congo red staining indicated that the optimal IPTG concentration is 0.6mM, consistent with the modeling group's prediction, which showed the relationship between IPTG input and mRNA expression. Figure 15 illustrates that the filtration of free-standing curli film produced by BL21(DE3) under 0.6mM IPTG induction appears redder than that produced by JF1, confirming the rationale behind the plasmid design optimization.
Figure 15: Photographs of the curli films from JF1 and BL21(DE3). Left: JF1. Right: BL21(DE3). The result of the Congo red staining shows that the curli fiber from BL21(DE3) is redder than JF1.
Figure 16: This picture exhibits the projected result of the concentration of Amyloid-like Curli Fiber Protein produced. The blue line shows the CsgA-AG4 inside the cell, and the red line shows the CsgA-AG4 transferred out of the cell. The concentration of intracellular CsgA in our system will be maintained at about 183μM.
However, filtration of bacterial solutions incubated with 0.8M guanidinium chloride (GdmCl) often resulted in blockages. The blockages appeared yellow and were not stained by Congo red. This obstruction made it difficult to filter the remaining curli fibers, particularly in BL21(DE3), which could not efficiently produce curli fiber films.
BL21(DE3) has the capability to form an abundant biofilm composed of fibers, proteins, nucleic acid, and exopolysaccharide material (Floyd, Eberly, and Hadjifrangiskou, 2017). This unique characteristic of BL21(DE3) may lead to yellow precipitation and difficulties in separating the amyloid protein nanofiber from the bacteria.
Furthermore, the T7 promoter is known for its strength, which could potentially result in the over-expression of curli fiber. CsgA protein forms toxic intracellular aggregates in the absence of CsgC protein. CsgC can inhibit CsgA expression when the CsgC-to-CsgA ratio is larger than 1: 500 (Evans et al., 2015). It might be possible that the T7 promoter-induced over-expression of CsgA, which led to a small amount of CsgC was not insufficient to inhibit CsgA protein expression. The excess CsgA protein formed toxic intracellular aggregates, which couldn't be secreted outside the bacteria and were harmful to the bacteria. The reduced bacterial population might explain the low-level protein expression.
However, the toxicity threshold of CsgA is unknown. Therefore, we aim to maintain the CsgC-to-CsgA ratio at around 1:500. The intracellular concentration of CsgA in our system will be approximately 183μM, while the intracellular concentration of CsgC is around 0.125 μM (Li et al., 2014). CsgC may not entirely inhibit CsgA nucleation in the cell, potentially affecting the biofilm and cell negatively. To address this issue, we plan to replace the T7 promoter with the tac promoter, which has slightly lower transcriptional efficiency, to prevent exceeding the toxicity threshold of CsgA.
To facilitate the flexible separation of CsgA, we selected the MC4100 strain. According to Adoni et al. (2022), MC4100 has a lower propensity to form biofilms, making it better suited for regulating CsgA expression. Since MC4100 cannot produce T7 RNA polymerase, we chose the tac promoter. Additionally, this promoter helps prevent overexpression of CsgA. The regulation efficiency of the tac promoter is several times lower than that of the T7 promoter (Deuschle et al., 1986).
Our goal was to reduce the expression of CsgA, thereby increasing the ratio of CsgC to CsgA and allowing CsgC to play a more restrictive role. We speculated that switching to the tac promoter could improve bacterial survival rates and subsequently increase the production of CsgA-AG4 fusion protein. Moreover, the tac promoter offers relatively strong regulation efficiency to ensure continuous protein expression.
We employed the pGEX-6P-1 plasmid to construct the pGEX-6P-1-CsgA-AG4 genetic pathway. Figure 17 illustrates the genetic circuit of pGEX-6P-1-CsgA-AG4. Similar to BL21(DE3), we knocked out the CsgA and CsgB genes to regulate the expression of the CsgA-AG4 fusion protein in the plasmid and enable easy separation of the CsgA-AG4 fusion protein via vacuum filtration. Figure 18 confirms the knockout of the CsgA and CsgB genes in MC4100.
Figure 17: The genetic circuit of the biosorbent synthesis for noble metal ions adsorption. IPTG induces this biological pathway. The tac promoter is chosen for the MC4100 strain. CsgA and MBP3 link with a GSGGSG linker.
Figure 18: The agarose gel electrophoresis of the DNA fragment in the genome from MC4100. Sample 1, sample 2, and sample 3 show the strips are 1 kb. Samples 5 and 6 have the highlight strip which are near 1.5kb. The length of the highlight strips is the same as the recombinant fragment which is 1528bp. This result means the CsgB and CsgA have been knocked out.
The high molecular weight of the GST protein in the pGEX-6P-1 plasmid posed a challenge. Even if the GST gene and the CsgA-AG4 gene were transcribed separately, there was a possibility that CsgA-AG4 could not be secreted from the channel due to molecular forces between the two proteins. Molecular dynamics simulations conducted by the modeling group indicated a high probability of interaction between CsgA-AG4 and GST protein. Figure 19 shows the molecular docking image of CsgA-AG4 and GST. The docking score results are available through the provided link. Based on this information, we deleted the GST genetic sequence from the plasmid. Figure 20 provides the pGEX-6P-1-CsgA-AG4 plasmid map.
Figure 19: The image of the molecular docking of CsgA-AG4 and GST protein. The molecular docking was produced by Amber and exhibited by PyMol.
Figure 20: pGEX-6p-1-CsgA-AG4 plasmid map created by SnapGene. This graph exhibits the biological pathway of CsgA-AG4 in the pGEX-6P-1 plasmid.
Following the knockout of the CsgB and CsgA genes from the MC4100 genome using lambda red, we transformed MC4100 (ΔCsgB, ΔCsgA) with the pGEX-6P-1-CsgA-AG4 plasmid using electroporation. Subsequently, bacterial expression was induced with IPTG, and the amyloid protein nanofiber was assessed via Congo red staining.
Based on the data from Congo red staining at various IPTG concentrations, the optimal concentration of IPTG is determined to be 0.4 mM, as supported by the model in Figure 21. The model also predicts that the ratio of CsgC to CsgA should be maintained at about 1:500. Figure 22 and 23 illustrate the comparison of OD490 between the experimental group (bacteria induced by IPTG and stained with Congo red) and the control group (bacteria without plasmid and without IPTG induction stained with Congo red), providing insights into CsgA-AG4 expression.
Figure 21: This figure displays the projected concentration of Amyloid-like Curli Fiber Protein produced by MC4100. The blue line represents intracellular CsgA-AG4, while the red line represents CsgA-AG4 transferred out of the cell. The concentration of intracellular CsgA in our system is maintained at about 63 μM.
Figure 22: This graph presents the relative protein expression levels of Amyloid-like Curli Fiber Protein produced by the MC4100 strain at various IPTG concentrations. The y-axis reflects the difference in absorbance values at 490 nm between the non-plasmid-transformed MC4100 strain subjected to Congo Red assay and the plasmid-transformed MC4100 strain induced with different IPTG concentrations. The x-axis shows the gradient of IPTG concentrations ranging from 0 mM to 1.5 mM, providing insights into the impact of IPTG concentration on protein expression.
Figure 23: This graph illustrates the influence of varying IPTG concentrations on the expression of Amyloid-like Curli Fiber Protein by the MC4100 strain. The y-axis represents the difference in absorbance values at 490 nm between the plasmid-transformed MC4100 strain, which remained uninduced by IPTG, and the same strain induced with a gradient of IPTG concentrations ranging from 1 mM to 1.5 mM. The x-axis represents the IPTG concentration gradient, providing insights into how IPTG regulates protein expression in MC4100.
Figure 24 demonstrates that free-standing curli films produced by MC4100 are redder and smoother than those from JF1 and BL21(DE3), confirming the suitability of selecting MC4100 strains and deleting the GST genetic sequence. Congo red staining was employed to verify the production of high-quality curli fiber films. Additionally, ICP-MS was used to detect silver ion adsorption, which is significant for validating the AG4 peptide produced.
Figure 24: These photographs of the curli films from JF1, BL21(DE3) and MC4100. Comparing these three pictures, MC4100 is the reddest. Bl21(DE3) is centered, and JF1 is the weakest red.
The study sought to validate the expression of the CsgA-AG4 fusion protein and assess its capacity for silver ion adsorption. Initial priorities included the determination of optimal temperature and duration for CsgA-AG4 to absorb silver ions. Temperature gradients explored comprised 4℃, 16℃, and 25℃, while temporal gradients consisted of 1 hour, 2 hours, 4 hours, and 8 hours.
Curli fiber films sourced from Jf1, BL21(DE3), and MC4100 were immersed in 40mL of a 4μM AgNO3 solution. A control group, comprising polycarbonate filter films, was concurrently established. Subsequent to this, the curli films from varying strains and the polycarbonate filter films underwent incubation within 4μM AgNO3 solutions, each with distinct temperature and duration parameters. Measurement of silver ion concentrations before and after adsorption was conducted through the utilization of Inductively Coupled Plasma Mass Spectrometry (ICP-MS), an analytical instrument expertly operated by Technician Xie Xiaoping. The adsorption capability of the CsgA-AG4 fusion protein was quantified by calculating the difference in silver ion concentrations pre- and post-adsorption.
The curli fiber films were incubated in the 4μM AgNO3 solutions at 25℃ for 1 hour, 2 hours, 4 hours, and 8 hours. Figure 25 reflects that the CsgA-AG4 fusion protein has the maximum adsorption efficiency by incubating for 8 hours. After that, the curli fiber films were incubated in the 4μM AgNO3 solutions at 4℃, 16℃, and 25℃ for 8 hours. Figure 26 indicates that 25℃ is the optimal temperature for CsgA-AG4 protein and that the protein absorbs more silver ions. The results of the exploration also reflected that the curli fiber films produced by MC4100 had the maximum adsorption efficiency to silver ions.
Figure 25: This graph presents the adsorption efficiency of CsgA-AG4 recombinant protein from three strains at 25℃ on different adsorption times. The maximum adsorption efficiency of CsgA-AG4 is from MC4100. This figure indicates the optimal adsorption time is 8 hours.
Figure 26: This graph of the adsorption efficiency of CsgA-AG4 recombinant protein from three strains at different temperatures for 8 hours. The optimal temperature is 25℃. The CsgA-AG4 protein of MC4100 has the maximum adsorption efficiency. The adsorption efficiency of protein from JF1 is the lowest.
The comparison between the curli fiber films between JF1, BL21(DE3), and MC4100 exhibited that MC4100 has the strongest affinity to silver ions. This conclusion was the same as the protein expression.
Following the determination of optimal temperature and incubation times, it was essential to investigate the influence of CsgA-AG4 protein activity at varying concentrations of AgNO3 solution.
Distinct concentrations of AgNO3 were established, spanning 4μM, 6μM, 8μM, 10μM, and 12μM. Curli films derived from different strains and polycarbonate filter films were subjected to incubation within these AgNO3 solutions, each maintained at 25℃ for an 8-hour duration. The concentration of silver ions before and after adsorption was quantified through ICP-MS analysis, expertly conducted by Technician Xie Xiaoping. The adsorption capability of the CsgA-AG4 fusion protein was characterized by the variance in silver ion concentration pre- and post-adsorption.
The results are depicted in Figure 27, illustrating that as AgNO3 concentration increased, the absorption efficiency exhibited a gradual decline. This suggests that elevated silver ion concentrations may marginally impact protein activity. Remarkably, even at high silver ion concentrations, the protein continued to demonstrate high adsorption efficiency.
Figure 27: This graph indicates the adsorption efficiency of CsgA-AG4 recombinant protein from three strains at 25℃ on different silver ions concentrations and incubated for 8 hours. The maximum adsorption efficiency of CsgA-AG4 is from MC4100.
Across a range of AgNO3 concentrations, the CsgA-AG4 protein consistently displayed exceptional affinity for silver ions, particularly when sourced from MC4100. According to China's wastewater discharge standards for electronic industry enterprises, the permissible limit for total silver content does not exceed 0.3mg/L (Ministry of Ecology and Environment of the People’s Republic of China, 2023). Post-application of AgNO3 by the CsgA-AG4 fusion protein, curli fiber films from MC4100 were found to treat AgNO3 concentrations equal to or less than 10μM, complying with national emission standards. In contrast, curli fiber films from BL21(DE3) and JF1 demonstrated the ability to treat maximum AgNO3 concentrations of 8μM and 6μM, respectively, in line with the national emission standards.
With the absorption capacity of the CsgA-AG4 fusion protein for silver ions established, the next phase sought to investigate the protein's capacity to reduce silver ions into nano-silver particles, observable through Scanning Transmission Electron Microscopy (STEM).
Three sample groups were prepared for STEM and Scanning Electron Microscope (SEM) analysis. Control groups comprised CsgA-AG4 protein on polycarbonate filter films from MC4100 and JF1, specifically prepared for SEM analysis. The experimental group encompassed CsgA-AG4 protein post-silver ion absorption, prepared for STEM analysis. In this group, the CsgA-AG4 fusion protein was scraped off and dissolved in 400μL of deionized water.
STEM and SEM analyses were conducted by Qingdao Yuance Test Technology Services Co., Ltd. Figures 28 and 29 depict SEM images of CsgA-AG4 protein produced by MC4100 and JF1 strains, with the CsgA-AG4 fusion protein highlighted. Figure 30 offers SEM images and elemental composition percentages, revealing the presence of silver elements within the CsgA-AG4 protein. Figure 31 presents SEM Elemental Mapping, delineating the distribution of various elements within the target protein, including silver. Figure 32 displays STEM-HAADF imaging, indicating the presence of nano-silver particles. The distribution of silver elements, including silver ions and silver elemental substances, is further evidenced through silver mapping and STEM-HAADF imaging.
Figure 28: Scanning Electron Microscopy (SEM) analysis. The experimenter used SEM to observe the fusion protein produced by the MC4100 strain. The part marked in red in the figure is the CsgA-AG4 fusion protein which can be seen clearly. The magnification of A, B, and C are 5 KX, 10 KX, and 20 KX respectively (done by Yuantest Laboratory).
Figure 29: Scanning Electron Microscopy (SEM) analysis. The experimenter used SEM to observe the fusion protein produced by the JF1 strain. The part marked in red in the figure is the CsgA-AG4 fusion protein which can be seen clearly. The magnification of A and B are 5 KX and 20 KX respectively (done by Yuantest Laboratory).
Figure 30: SEM electron microscopy shows the image and the percentage of each element in the protein. The experimenters selected the central region of the whole protein for elemental content analysis. This allowed for the intuitively visual observation of the distribution and content of various elements within the target protein. The presence of silver elements can demonstrate the absorption of silver by the target protein (done by Yuantest Laboratory).
Figure 31: SEM Elemental Mapping of CsgA-AG4 after absorbing silver ions. (a) Element carbon distribution (red). (b) Element nitrogen distribution (blue). (c) Element oxygen distribution (purple). (d) Element sulfur distribution (dark green). (e) Element silver distribution (yellow). (f) Element phosphorus distribution (light green). Scale bar: 1μm (done by Yuantest Laboratory).
Figure 32: STEM-HAADF imaging of nano-silver synthesis on CsgA-AG4 fusion protein (30kV). The magnification of A~G are 10.00KX, 20.00KX, 10.00KX, 20.00KX, 10.00KX, 50.00KX, 50.00KX (done by Yuantest Laboratory).
STEM-HAADF imaging conclusively demonstrates the reduction of silver ions into nano-silver particles by AG4 peptides, substantiating the presence of silver elemental substances. The silver element mapping affirms the distribution of silver elements on the curli fiber membrane, encompassing both silver ions and silver elemental substances. The prevalence of yellow color in the silver mapping image, surpassing that in the STEM-HAADF image, suggests potential electrostatic interactions between silver ions and the CsgA-AG4 protein. A detailed explanation of this is expressed on the wiki of the Model and Figure 33.
Figure 33: The image of the silver mapping and the STEM-HAADF. The left image is the silver mapping by SEM and the yellow color distribution shows the silver element, including silver elemental substances and silver ions. The middle and right images are the STEM-HAADF which exhibits nano-silver (silver elemental substances).
These findings collectively underscore the multifaceted capabilities of the CsgA-AG4 fusion protein, spanning silver ion adsorption and subsequent reduction into nano-silver particles.
Metallothioneins are low molecular weight proteins rich in cysteine residues that can adsorb heavy metals and chelate these metals in an inactive form (Carpenè et al., 2007).
Among them, the cyanobacterial metallothionein SmtA from Synechococcus PCC 7942 contains nine cysteine residues, four zinc ions, and two histidine residues, which directly contribute to the formation of the Zn4Cys9His2 cluster (Blindauer, 2011).
SmtA can sense and bind specific heavy metal ions such as cadmium, lead, and zinc, aiding cells in regulating their tolerance and metabolism of these toxic metals. It prevents these metals from entering or translocating into the cell by forming complexes with the metal ions, thus protecting the cell from heavy metal toxicity.
In order to enhance the affinity for heavy metal ions and improve the metal ion chelation capacity near the protein surface, we designed a variant of the cyanobacterial metallothionein SmtA, called MSmtA4.
When selecting mutation sites, we focused on positions that would not affect the protein's spatial structure and function. When choosing mutated amino acids, we prioritized positively charged amino acids and considered their accessibility on the protein surface to enhance electrostatic interactions.
To achieve the goal of mutation, we aimed to increase the protein's contact area with heavy metal ions while enhancing its binding capability to them. Saffar et al. found that mutating Lys45 in SmtA to Cys results in a larger accessible surface area (ASA) and smaller root-mean-square fluctuation (RMSF) values.
Additionally, Arg 26, Lys 8, and Lys 22 have structural similarities to Lys45. This result inspired us to mutate these four positions to increase the accessible surface area (ASA) and electrostatic interactions, thereby enhancing its performance as a heavy metal biosorbent, improving SmtA's affinity for heavy metal ions, and chelation capacity.
Due to the instability of MSmtA4, it cannot be directly used for practical wastewater treatment. We are considering employing immobilization technology to prepare heavy metal bioadsorbents containing MSmtA.
Immobilization technology is a method that immobilizes free microorganisms onto a carrier with the aim of improving the mechanical strength, stability, and reusability of the microorganisms. This technology is commonly applied in enzyme immobilization and microbial immobilization (Sheldon and Pelt, 2013).
Carbohydrate-Binding Modules (CBMs) are components of several enzymes that can bind to specific carbohydrates. One of their primary functions is to construct specific bifunctional proteins (Oliveira et al., 2015).
Cellulose is an environmentally friendly chemically inert material with promising sustainability. CBMs can recognize and selectively bind to features on the crystal surface, providing potential possibilities for cellulose modification. By introducing Carbohydrate-Binding Modules (CBMs), our goal is to tightly attach the protein to cellulose, creating a bioadsorbent with potential applications.
In the XJTLU-2023 project, we have chosen a family 2 CBM from endoglucanase A of C. fimi, which is commonly used for enzyme immobilization. According to the research by Kevin Aïssa and others, CBMs exhibit strong affinity for crystalline cellulose.
Introducing CBM to modify the cellulose surface can provide robust non-covalent modification, enhance the redispersibility of functionalized cellulose nanocrystals after drying, and improve suspension stability through spatial interactions (Aïssa et al., 2019).
To verify protein expression, monitor the immobilization process, and study protein dynamics, we plan to add superfolder Green Fluorescent Protein (sfGFP) to the fusion protein. This choice is based on the following reasons:
Therefore, the choice to add sfGFP, a superfolder Green Fluorescent Protein, to the fusion protein will help in more accurately monitoring protein expression and dynamics, improving the reproducibility and reliability of the experiments.
In short summary, these components together create a fusion protein with several advantages, including superior heavy metal adsorption capabilities, optimized protein expression, improved stability, enhanced functionality, and ease of purification.
In this study, we selected a family 2 CBMs from endoglucanase A of C. fimi, commonly used for enzyme immobilization, to achieve tight binding with microcrystalline cellulose. Subsequently, we obtained the amino acid sequence of this CBMs and its corresponding CDS region from the NCBI gene database. And we obtained the sfGFP sequence from the Snapgene database.
To ensure that CBMs, sfGFP, SUMO Tag, and the metallothionein MSmtA4 function within the fusion protein without interfering with each other, we used flexible Linker 1 (GSGGAGGS), Linker 2 (GGGSPTGG), and Linker 3 (GSGSGS) to connect them. The purpose of these linkers is to provide a flexible sequence between the various proteins, allowing them to move freely and maintain their independent functions.
By introducing these flexible linkers, we can ensure that the binding between various components within the fusion protein does not impede their respective structures and functions. This helps achieve the expression of the fusion protein while preserving the biological activity of the proteins, enabling their effective use in specific experiments or applications.
To construct the mutant protein MSmtA4, we employed gene synthesis technology and selected the pUC-GW-Kan plasmid as the amplification vector for subsequent large-scale amplification. The MSmtA4 fragment will be used as the "Insert" portion in Gibson Assembly.
Firstly, we synthesized the pUC_GW_Kan-SUMO-SmtA-CBM-sfGFP plasmid (by Genewiz), which contains all the necessary components to be verified and the components to be added. To obtain a plasmid suitable for Gibson Assembly, we designed a set of primer pairs, primer F (GCACCAGGTTGTCGTGTAGACT) and primer R (AGATCCTGATCCAGAGCCGC). For PCR amplification of the existing pUC_GW_Kan-SUMO-SmtA-CBM-sfGFP plasmid to obtain a PCR fragment 5' CBM-sfGFP-pUC_GW-Kan-SUMO 3' (Vector) containing plasmid homologous sequences.
Figure 1: The PUC-GW-KanR plasmid containing the required fragment. The fragment SUMO-SmtA-CBM-sfGFP contained will be used for Gibson assembly.
Next, we added the purified PCR product to a Master Mix solution for Gibson Assembly cloning. This is an efficient and seamless method for correctly assembling these two DNA fragments to obtain a plasmid containing MSmtA4. This process ensures the correct linkage of the two segments, and the efficiency of Gibson Assembly ensures that we can efficiently obtain the target plasmid.
Figure 2: Primer1 (sequence: AGATCCTGATCCAGAGCCGC) and Primer2 (sequence: GCACCAGGTTGTCGTGTAGACT) were designed for amplifying the required CBM-sfGFP-PUC-SUMO fragment from the PUC-GW-KanR plasmid using PCR technology. This fragment will serve as the linearized vector in Gibson assembly. This fragment will be used as a linearization carrier in Gibson assembly.
Subsequently, we conducted a 1% agarose gel electrophoresis test to observe the gel and determine if we obtained clearly visible bands with the correct molecular weight. This method allows us to accurately assess whether the assembly is correct, i.e., whether the desired genetic changes have been successfully introduced to ensure we have obtained the target plasmid containing MSmtA4.
Figure 3: (A) The PCR product of the M-SmtA4 fragment. (B) The PCR product of the SUMO-PUC-sfGFP-CBM fragment. (C) The double enzyme digestion of SUMO-M-SmtA4-CBM-sfGFP in pUC _GW_kan plasmid after Gibbson assembly. (D) The double enzyme digestion of SUMO-SmtA-CBM-sfGFP and SUMO-M-SmtA4-CBM-sfGFP in pET-21a plasmid.
Additionally, we chose the pET21a vector as the subcloning vector. We constructed the pET21a(+)-SUMO-SmtA-CBM-sfGFP pathway by inserting the SUMO-SmtA/MSmtA-CBM-sfGFP genes between the NdeI and BamHI sites of the pET21a vector for subsequent obtaining of the pET21a-SUMO-SmtA-CBM-sfGFP (as a control) and pET21a-SUMO-MSmtA4-CBM-sfGFP plasmids through double enzyme digestion.
Figure 4: Pathway constructed on pET21a (+) expression vector. The plamid map is created by Snapgene.
Figure 5: The genetic circuit of the biosorbent synthesis for heavy metal ions adsorption. IPTG induces this biological pathway. SUMO, SmtA, CBM, and sfGFP form the fusion protein.
The expression plasmids pET21a-SUMO-SmtA-CBM-sfGFP and pET21a-SUMO-MSmtA-CBM-sfGFP were transformed into TOP10 competent cells for large-scale cultivation. Subsequently, the pET21a-SUMO-SmtA-CBM-sfGFP and pET21a-SUMO-MSmtA-CBM-sfGFP plasmids were extracted and transformed into the expression host Escherichia coli BL21(DE3) for the expression of recombinant fusion proteins (SUMO-SmtA-CBM-sfGFP and SUMO-MSmtA4-CBM-sfGFP).
Figure 6: In the MSmtA4 protein, Cys14, Cys47, Cys52, and Cys54 form ionic bonds with cadmium ions. The docking score is -6.133kcal/mol.
Figure 7: In the SmtA protein, Cys14, Cys47, Cys52, and Cys54 form ionic bonds with cadmium ions. The docking score is -6.091kcal/mol.
The transformed cells were grown in 500 mL of LB liquid medium at 37°C with a final concentration of 100 μg/mL Amp. When the OD600 reached 0.5 ± 0.05, protein expression was induced by adding Isopropyl-β-D-thiogalactoside (IPTG) to the culture and incubating at 16°C for 18 hours.
After 18 hours of IPTG induction, cells displayed significant fluorescence compared to uninduced cells, indicating successful expression of the fusion proteins. Cells were collected by centrifugation (10 min, 12000g, 4°C), then lysed by sonication in lysis buffer (50mM Tris-HCl, pH 7.8, 0.2mM PMSF) at a five-volume ratio (v/w).
The cells were considered lysed when the bacterial solution appeared relatively clear. After centrifuging the cell lysate at 10000g for 20 minutes, the supernatant was collected and used for the preparation of bioadsorbents.
The fusion protein was gently mixed with microcrystalline cellulose at a ratio of 1:250 at room temperature for one hour to ensure full contact between microcrystalline cellulose and the protein. After shaking, the supernatant was removed by centrifugation (10000g, 5 minutes).
Subsequently, the precipitate was washed with deionized water to remove any residual protein that had not bound to microcrystalline cellulose and obtained the final Biosorbent.
A noticeable decrease in protein content was observed by comparing the supernatant obtained after centrifugation with the protein content before binding to microcrystalline cellulose. This preliminary observation indicates binding of the protein to microcrystalline cellulose.
Figure 8: Comparison of protein content of fusion protein containing CBM before and after binding with microcrystalline cellulose by BCA method.
Subsequently, scanning electron microscopy (SEM) was used to observe the binding of protein to microcrystalline cellulose to confirm this hypothesis.
Figure 9: Scanning Electron Microscopy (SEM) analysis. The microstalline in the figure A is soomth, representing Microcrystalline cellulose do not bound to any protein. The microstalline in the figure B is rough, representing Microcrystalline cellulose do bind to proteins containing CBM (done by Yuantest Lab).
This series of experimental steps is helpful in verifying whether the fusion protein containing CBM has successfully bound to microcrystalline cellulose, laying the foundation for the preparation of heavy metal bioadsorbents.
Then, we measured the adsorption efficiency of biosorbents prepared from mutant and wild-type proteins under the same temperature, time, and pH conditions in a mixed solution containing cadmium, lead, and copper, to determine whether the mutant can improve the heavy metal adsorption rate.
Figure 10: The producer of dealing with the heavy metal ions in the lab. The fusion protein of SUMO-MSmtA4-CBM-sfGFP binds on the microcrystalline cellulose and absorbs heavy metal ions.
The mixture was gently shaked on a shaker (100 rpm, 25°C, pH=6) for 4 hours. The adsorption capacity of this biosorbent for heavy metal ions was measured using ICP-MS technology.
Under conditions of 25 °C, 4 hours, and pH 6, The experimental results indicate that the Biosorbent containing MSmtA4 has a higher absorption capacity for heavy metal ions compared to the Biosorbent prepared with wild-type protein.
Figure 11: The absorption efficiency of MSmtA4 in a mixed system containing copper, cadmium, and lead heavy metal ions (all 20mg/L).
Figure 12: The figure shows the removal efficiency of SUMO-MSmtA4-CBM-sfGFP fusion protein in a mixed solution containing 50 mg/L cadmium ions, 20 mg/L copper ions, and 20 mg/L lead ions.
Figure 13: The effect of microcrystalline cellulose in the mixed system.
Furthermore, theoretical results also support this finding. The mutation of the four residues to obtain MSmtA4, when compared to SmtA, shows a significant enhancement in the protein's electrostatic interactions after these four mutations. This enhancement makes it more capable of adsorbing heavy metal ions and results in a stronger binding affinity.
We have confirmed that the fusion protein containing CBM can bind to microcrystalline cellulose through two methods: The BCA Protein Assay and SEM scanning electron microscopy.
We present the experimental results visualized through various graphs and images. Furthermore, by utilizing sfGFP to display green fluorescence under natural light, we can directly observe protein expression and immobilization.
This study aims to enhance the bioremediation capacity of heavy metals, which has significant potential applications in environmental protection and wastewater treatment.
We constructed SUMO-MSmtA4-CBM-sfGFP fusion proteins and SUMO-MSmtA4-CBM-sfGFP fusion proteins (control group) to determine whether mutations in MSmtA4 fusion proteins can improve heavy metal adsorption efficiency. Experimental results indicate that bioremediation agents prepared using MSmtA4 fusion proteins exhibit significantly enhanced heavy metal adsorption capacity under specific conditions.
Furthermore, different concentrations of IPTG have a substantial impact on protein expression levels. Therefore, we have decided to further investigate the relationship between IPTG concentration and protein content.
IPTG (Isopropyl β-D-1-thiogalactopyranoside) is an analog of the substrate of β-galactosidase and has strong inductive properties. Under IPTG induction, the inducer forms a complex with the repressor protein, causing a conformational change in the repressor protein. This change prevents it from binding to the target gene, leading to efficient gene expression.
The lac operon in E. coli contains three structural genes: Z, Y, and A, encoding β-galactosidase, permease, and acetyltransferase, respectively. LacZ hydrolyzes lactose into glucose and galactose, or converts it into allolactose. LacY facilitates the entry of lactose from the environment into the cell. LacA transfers acetyl groups from acetyl coenzyme A to β-galactosides, involving detoxification. Additionally, there is a regulatory sequence O, a promoter sequence P, and a regulatory gene I. The I gene encodes a repressor protein that can bind to the operator sequence site O, keeping the lac operon under repression and in a closed state. Upstream of the promoter sequence P, there is a CAP binding site that activates protein binding, a gene involved in metabolite breakdown. The regulation region of the lac operon is formed by the P sequence, O sequence, and CAP binding site. These three genes are regulated by the same regulatory region, allowing for the coordinated expression of gene products.
In the absence of lactose, the lac operon is under repression. In this state, the lac repressor protein expressed under the control of the I sequence binds to the O sequence, preventing RNA polymerase from binding to the P sequence, inhibiting transcription. When lactose is present, the lac operon can be induced. In this operon system, the true inducer is not lactose itself. Lactose enters the cell and is converted into allolactose by β-galactosidase catalysis. Allolactose acts as an inducer molecule, binding to the repressor protein, causing a conformational change that results in the dissociation of the repressor protein from the O sequence, allowing transcription to occur.
The action of Isopropyl β-D-1-thiogalactopyranoside (IPTG) is similar to that of allolactose. It is a highly effective inducer, is not metabolized by bacteria, and is stable. Therefore, it is widely used in laboratory experiments.
Finding the optimal induction concentration and time for IPTG (Isopropyl β-D-1-thiogalactopyranoside) is a common experimental step in the expression of recombinant proteins in a recombinant protein expression system.
Finding the optimal IPTG concentration and induction time ensures that the target protein is induced to express at the right time, maximizing protein yield. Too low a concentration or time may result in inadequate expression, while too high a concentration or time may lead to unnecessary toxicity or resource wastage.
At the same time, excessively high IPTG concentration or long induction time may impose an unnecessary burden on host cells, leading to decreased cell growth and health. This can result in unstable expression, cell death, or unnecessary energy and resource consumption.
Additionally, excessive IPTG concentration may lead to overexpression of the target protein, potentially causing protein instability, aggregation, and precipitation, which can affect its purity and activity. Therefore, finding the optimal IPTG induction concentration and time is crucial for achieving the best protein expression results in a recombinant protein expression system, while ensuring cell health and efficient resource utilization.
Two plasmid pET21a-SUMO-SmtA-CBM-sfGFP and pET21a-SUMO-MSmtA-CBM-sfGFP were inserted into BL21(DE3) strain. IPTG would induce and influence the fusion protein expression. The protein expression levels could be reflected through fluorescence intensities due to the sfGFP expression. Hence, we set a gradient of the concentrations of IPTG to find the optimal concentration of the IPTG. When the protein is expressed more, it could emit more fluorescence. The fluorescence intensities were detected by the microplate reader.
The E. coli BL21 recombinant strains containing the expression plasmids pET21a-SUMO-SmtA-CBM-sfGFP and pET21a-SUMO-MSmtA-CBM-sfGFP were separately inoculated into LB liquid medium containing 100 μg/mL Amp and 2% glucose and incubated overnight at 37°C.
The overnight cultures were then inoculated at a 1:50 ratio into 5 bottles of 50 mL fresh LB liquid medium containing 50 μg/mL Amp. When the OD600 reached 0.5±0.05, IPTG was added to final concentrations of 0.2, 0.4, 0.6, 0.8, and 1.0 mmol/L, respectively.
Figure 15: The relationship between IPTG concentration and Fluence Intensity (512nm). The concentration of 0.4mM IPTG has a good effect on the induction of mutant proteins, while the concentration of 0.8mM IPTG has a good effect on the induction of wild-type proteins.
Figure 16: Predicting the Effect of IPTG Concentration on Protein Content through Modeling.
Figure 17: Predicting the Effect of Time on Protein Content under 0.4mM IPTG Induction through Modeling.
At the same temperature and after the same induction period, 1 mL of bacterial culture with varying IPTG concentrations was collected. The cells were then centrifuged to collect the precipitate for subsequent analysis using the BCA method and fluorescence spectroscopy.
This analysis aimed to assess the impact of different IPTG concentrations on protein expression levels. The analysis was conducted to determine the IPTG concentration and induction time that yield the highest protein expression level.
A series of inductions at different IPTG concentrations (0.2mM, 0.4mM, 0.6mM, 0.8mM, 1mM) were performed, and protein levels were determined using The BCA Protein Assay.
It was established that under 0.4mM IPTG induction, the mutant protein achieved the highest protein content, while under 0.8mM IPTG induction, the wild-type protein exhibited the highest protein yield.
Furthermore, a standard curve plotted using the BCA Protein Assay (y=0.0002x+0.1091) revealed a gradual increase in protein content with increasing IPTG concentration, ultimately peaking at the 0.4mM IPTG concentration stage. This indicates that the highest protein yield was obtained under 0.4mM IPTG induction.
In the process of removing or separating heavy metals, finding the optimal adsorption time and temperature conditions is a crucial step to enhance the efficiency of protein binding to heavy metal ions. Typically, the adsorption efficiency is influenced by time and temperature. By precisely determining the optimal adsorption time and temperature conditions, the adsorption efficiency can be maximized, thereby effectively removing or separating the target heavy metals.
Furthermore, identifying the best adsorption time and temperature conditions can lead to time and resource savings. Prolonged adsorption time or high temperatures may increase processing costs and extend processing time, while too short an adsorption time or low temperatures may not achieve sufficient adsorption efficiency. It is worth noting that different heavy metal ions exhibit different adsorption behaviors under different conditions. Through optimization of adsorption time and temperature, selectivity can be adjusted to selectively remove or separate specific heavy metals.
In mixed heavy metal solutions, different heavy metals may compete and interact with the adsorbent. By optimizing the conditions, this competitive adsorption can be reduced, ensuring that the target heavy metals are efficiently adsorbed.
Performance during the adsorption process is critical in industrial or environmental applications. By determining the optimal adsorption time and temperature, the adsorption system can achieve optimal performance, resulting in better treatment outcomes.
Additionally, finding the best adsorption conditions offers several advantages, including time and resource savings. Determining the optimal adsorption conditions can reduce the time and resource wastage in experiments.
Excessive adsorption time and high temperatures can increase operational time, energy costs, and consumable costs. Moreover, by identifying the optimal adsorption conditions through a series of experiments, result repeatability can be improved, which is crucial for applications requiring consistency in production and manufacturing.
We used inductive coupled plasma-mass spectrometry (ICP-MS) to measure the concentrations of the heavy metal ions. The amount of metal ions adsorbed by the protein can be expressed by the differences between the concentrations of the metal solution before adsorption and the concentrations of the metal solution after adsorption. We set different gradients of temperatures and times to explore the optimal temperature and how long it takes for proteins to adsorb heavy metal ions to reach saturation.
We selected three different temperatures, namely 4°C, 16°C, and 25°C, with the same concentration of heavy metal ions (50 mg/L Cd2+). At 2 hours, 4 hours, 6 hours, and 8 hours, we collected partial supernatant samples and analyzed the residual metal ion concentrations using ICP-MS.
This analysis allowed us to assess the influence of different temperatures and durations on the protein adsorption capacity. Subsequently, we identified the temperature and adsorption duration that yielded the highest protein adsorption efficiency.
Figure 18: Adsorption Efficiency of SUMO-SmtA-CBM-sfGFP Prepared Biosorbent at Different Times under Three Temperatures.
Figure 19: Adsorption Efficiency of SUMO-MSmtA4-CBM-sfGFP Prepared Biosorbent at Different Times under Three Temperatures.
Figure 20: Comparison of the Adsorption Capacities of Biosorbents Prepared with Fusion Proteins Containing MSmtA4 and SmtA at 25°C, pH=6.
We found that at around 30 minutes, the biosorbent had already absorbed the majority of the heavy metal ions. With prolonged time, the adsorption efficiency gradually decreased, reaching a minimum at four hours. However, after four hours, the adsorption efficiency began to recover, and by 8 hours, it had essentially returned to its peak. Therefore, to ensure the highest adsorption capacity, the optimal adsorption time should be set at 8 hours.
The biosorbent exhibited minimal fluctuations and strong adsorption capacity at 25°C. Hence, it is recommended to use 25°C as the practical operating temperature.
Aïssa, K. et al. (2019) ‘Functionalizing cellulose nanocrystals with click modifiable carbohydrate-binding modules’, Biomacromolecules, 20(8), pp. 3087–3093. doi:10.1021/acs.biomac.9b00646
Adoni, P. et al. (2022) ‘Polymer-induced biofilms for enhanced biocatalysis’ Materials Horizons, 9(10), pp. 2592-2602. Available at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9528183
Blindauer, C. A. (2011) 'Bacterial metallothioneins: past, present, and questions for the future' Journal of Biological Inorganic Chemistry, 16, pp. 1011-24. Available at: https://doi.org/10.1007/s00775-011-0790-y
Carpenè, E., Andreani, G., and Isnai, G. (2007) 'Metallothionein functions and structural characteristics.' Journal of Trace Elements in Medicine and Biology, 21, pp. 35-39. Available at: https://doi.org/10.1016/j.jtemb.2007.09.011
Courchesne, N.M.D. et al. (2017) ‘Scalable Production of Genetically Engineered Nanofibrous Macroscopic Materials via Filtration’ ACS Biomaterials Science & Engineering, 3(5), pp. 733-741. Available at: https://doi.org/10.1021/acsbiomaterials.6b00437
Datsenko, K.A. and Wanner, B.L. (2000) ‘One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products’ PNAS, 97(12), pp. 6640-6645. Available at: https://doi.org/10.1073/pnas.120163297
Deuschle, U. et al. (1986) ‘Promoters of Escherichia coli: a hierarchy of in vivo strength indicates alternate structures’ The EMBO Journal, 5(11), pp.2987-2994. Available at: https://doi.org/10.1002/j.1460-2075.1986.tb04596.x
Evans, M.L. et al. (2015) ‘The Bacterial Curli System Possesses a Potent and Selective Inhibitor of Amyloid Formation’ Molecular Cell, 57(3), pp. 445-455. Available at: https://doi.org/10.1016/j.molcel.2014.12.025
Floyd, K.A., Eberly, A.R., and Hadjifrangiskou, M. ‘3 - Adhesion of bacteria to surfaces and biofilm formation on medical devices’ Biofilms and Implantable Medical Devices, pp.47-49. Available at: https://doi.org/10.1016/B978-0-08-100382-4.00003-4
Li, G. et al. “Quantifying absolute protein synthesis rates reveals principles underlying allocation of cellular resources” Cell vol. 157,3 (2014): 624-35. doi:10.1016/j.cell.2014.02.033
Ministry of Ecology and Environment of the People’s Republic of China (2023) Guideline on available techniques of water pollution prevention and control for electronic industry. Available at: https://www.mee.gov.cn/ywgz/fgbz/bz/bzwb/kxxjszn/202306/t20230621_1034274.shtml
Oliveira, N. M. et al. (2015). ‘Biofilm Formation As a Response to Ecological Competition’ PLoS Biology, 13, e1002191. Available at: https://doi.org/10.1371%2Fjournal.pbio.1002191
Puchtler, H., Sweat, F. and Levine, M. (1962) ‘On the binding of Congo red by amyloid’ Journal of Histochemistry & Cytochemistry, 10(3), Available at:
https://doi.org/10.1177/10.3.355
Sheldon, R. A. and Pelt, V. S. (2013) 'Enzyme immobilisation in biocatalysis: why, what and how’ Chemical Society Reviews, 42, pp. 6223-35. Available at: https://doi.org/10.1039/c3cs60075k