As we know, CsgB is actively involved in intracellular assembly with CsgA (Hammer et al., 2007). In the absence of CsgB, CsgA can self-assemble extracellularly (Wang et al., 2008). It is anticipated that the expression of the native CsgA protein from the genome might potentially interfere with the expression of our engineered CsgA-AG4 fusion protein. Consequently, we devised a strategy to knock out the CsgA gene within the genomes of both BL21(DE3) and MC4100 strains.
Notably, in the genomes of these strains, the CsgBAC genes are situated within the same genetic pathway and regulated by a common promoter. Therefore, we opted to simultaneously knock out the CsgA and CsgB genes while retaining the CsgC gene. This decision was made to facilitate the future secretion of the target fusion protein. It's worth mentioning that Dr. Zhu, a researcher on campus, has successfully employed homologous recombination for gene knockout, and we have adopted the lambda red gene knockout method for our purposes. We hope that this gene knockout approach can serve as a valuable reference for future iGEM teams. For more specific details, please refer to our notes and protocols.
Figure 1: The mechanism of the curli biogenesis system. A, B, C, E, F, and G represent CsgA, CsgB, CsgC, CsgE, and CsgF proteins respectively. Nter and Cter represent the N-terminal and C-terminal of the protein. CsgA: major curli, the structure constituting the amyloid fibers. CsgB: binding the CsgA on the cell surface. CsgC: prevent the formation of the pre-amyloid fibers. CsgE, CsgG, CsgF: the polymerase of the secreted protein (Yan et al., 2020).
Figure 2: This figure illustrates why CsgA and CsgB in the genome can be knocked out. When CsgB in the genome is missing, CsgA detaches from the bacterial cell outer membrane and self-assembles in vitro. When CsgA in the genome is missing, the curli fiber with AG4 protein can be expressed by the plasmid we added without the interference of the curli fiber without AG4.
Figure 3: The pKD46 plasmid is used for expression of recombinase.
Even though CsgA and CsgB genes have been successfully removed from the genomes of both strains, a key distinction exists between them. BL21(DE3) possesses a T7 RNA polymerase gene within its genome, whereas the MC4100 genome lacks this specific T7 RNA polymerase gene. As a result, these two strains rely on different promoters located on separate plasmids to induce gene expression.
Below, we have provided the genetic maps of these two plasmids, and we hope that these resources will prove valuable to future IGEM teams.
Figure 4: The genetic circuit of the biosorbent synthesis for noble metal ions adsorption. IPTG induces this biological pathway. T7 promoter is chosen for the BL21(DE3) strain. CsgA and AG4 link with GSGGSG linker.
Figure 5: This graph displays the CsgA-AG4 (BBa_K4968008) biological pathway in the pET-21a(+) plasmid.
Figure 6: The genetic circuit of the biosorbent synthesis for noble metal ions adsorption. IPTG induces this biological pathway. Tac promoter is chosen for the MC4100 strain. CsgA and MBP3 link with GSGGSG linker.
Figure 7: This graph displays the CsgA-AG4 (BBa_K4968008) biological pathway in pGEX-6P-1 plasmid.
The Cyanobacterial metallothionein SmtA is derived from Synechococcus PCC 7942 and belongs to the metallothionein family. SmtA plays a crucial role in regulating trace element concentrations and detoxifying heavy metals within the organism. Additionally, it is involved in hormone regulation, cellular metabolism, control of cell differentiation and proliferation, and participates in UV-induced reactions and free radical scavenging (Haq, 2003).
In order to enhance the surface affinity for heavy metal ions and improve the ability of the protein to chelate heavy metal ions near its surface, we designed a variant named MSmtA4 based on the Cyanobacterial metallothionein SmtA. We placed particular emphasis on selecting mutation sites that would not affect the spatial structure and function of the protein.
Along with a positive charge, to enhance electrostatic interactions. For the purpose of mutation, we hope to increase the contact area between proteins and heavy metal ions, and enhance their ability to bind to heavy metal ions. Saffar et al. (2015) found that mutating Lys45 in SmtA to Cys resulted in a lager surface accessibility area and smaller root mean square fluctuation (RMSF) values. In addition, Arg 26, Lys 8 and Lys 22 have similar structures to Lys45 . This result gave us inspiration, and we decided to mutate more sites to enhance electrostatic interactions.
Figure 8: 3D structure diagram of MSmtA4 predicted by alphafold2.
Therefore, we selected Arg 26, Lys 8, Lys45 and Lys 22, and mutated them to Cys. We hope this mutation can effectively strengthened the protein's adsorption capacity for heavy metal ions, especially cadmium ions. We hope that this mutated protein can serve as a valuable reference for future IGEM teams. For more specific details, please refer to our laboratory notes and protocols.
Figure 9: In the MSmtA4 protein, Cys14, Cys47, Cys52, and Cys54 form ionic bonds with cadmium ions. The docking score is -6.133kcal/mol.
Figure 10: In the SmtA protein, Cys14, Cys47, Cys52, and Cys54 form ionic bonds with cadmium ions. The docking score is -6.091kcal/mol.
Gibson Assembly is a molecular biology technique used to quickly and effectively connect DNA fragments together to construct or edit DNA molecules. This technology was first developed by Daniel Gibson in 2009 and has been widely applied in the fields of synthetic biology, genetic engineering, and molecular biology.
The main advantage of Gibson Assembly is that it is a simple and powerful seamless or traceless cloning method that does not require restriction endonucleases, making it easy to connect DNA fragments together without introducing specific restriction endonuclease sites. Gibson Assembly has been widely used in the scientific community and can assemble multiple DNA fragments in an efficient and seamless cloning method. Regardless of fragment length or end compatibility, multiple overlapping DNA fragments can be joined in a single isothermal reaction.
Figure 11: The PUC-GW-KanR plasmid containing the required fragment. The fragment SUMO-SmtA-CBM-sfGFP contained will be used for Gibson assembly.
Figure 12:The genetic map of CBM-sfGFP-pUC_GW_Kan R-SUMO (BBa_K4968017). Primer1 (sequence: AGATCCTGATCCAGAGCCGC) and Primer2 (sequence: GCACCAGGTTGTCGTGTAGACT) were designed for amplifying the required CBM-sfGFP-pUC-SUMO fragment from the pUC-GW-Kan R plasmid using PCR technology. This fragment will serve as the linearized vector in Gibson assembly. This fragment will be used as a linearization carrier in Gibson assembly.
Figure 13: MSmtA4 agarose gel electrophoresis strips. Use 2% agarose gel electrophoresis to verify whether the PCR product is Insert (MSmtA4)(BBa_K4968000).
Figure 14: CBM-sfGFP-PUC-SUMO agarose gel electrophoresis strips. Use 0.8% agarose gel electrophoresis to verify whether the PCR product is Vector (CBM-sfGFP-pUC_GW_Kan R-SUMO).(BBa_K4968017).
We obtained the MSmtA4 (BBa_K4968000) fragment using gene synthesis technology and used it as the Insert section. At the same time, we used PCR technology to obtain the CBM-sfGFP-pUC_GW_Kan R-SUMO (BBa_K4968017) linearization vector from the existing pUC-SUMO-SmtA-CBM-sfGFP plasmid.
Then, we amplified the fragment and vector using PCR, identified the fragment size, and purified the DNA fragment; Mix the Insert and Vector parts in MasterMix solution to obtain the target fragment. For detailed steps, please refer to the laboratory notes and Protocol section.
Below, we provide plasmid maps obtained through the Gibson assembly, and we hope these resources will be valuable to future IGEM teams.
Figure 15: This graph indicates the SUMO-MSmtA4-CBM-sfGFP (BBa_K4968021). By using Gibson assembly, we seamlessly connected the Insert (MSmtA4) (BBa_K4968000) and Vector (CBM-sfGFP-pUC_GW_Kan R-SUMO) (BBa_K4968017) to obtain the plasmid pUC-SUMO-MSmtA4-CBM-sfGFP. Subsequently, using NdeI and BamHI double enzyme digestion to ligate the SUMO-MSmtA4-CBM-sfGFP fragment into the expression vector pET-21a (+).
Carbohydrate Binding Modules (CBMs) are components of several enzymes that can bind to specific carbohydrates, and one of their primary functions is to be used in the construction of specific bifunctional proteins (Oliveira et al., 2015).
Cellulose is an environmentally friendly material commonly used as an immobilization matrix. CBMs can recognize and selectively bind to characteristics on the crystal surface, providing possibilities for modifying cellulose.
In the XJTLU-2023 project, we have chosen a family 2 CBM from endoglucanase A of C.fimi, which is commonly used for enzyme immobilization. Research by Kevin Aïssa and others found that CBMs exhibit a strong affinity for crystalline cellulose. Introducing CBMs to modify the cellulose surface can provide powerful non-covalent modifications, enhancing the redispersibility of functionalized cellulose nanocrystals after drying and improving suspension stability based on spatial interactions (Aïssa et al., 2019).
Therefore, we decided to use this environmentally friendly and low-cost chemical inert material microcrystalline cellulose as the base for our protein fixation. In order to test the binding ability of CBM to microcrystalline cellulose, we gently shook the fusion protein containing CBM, sfGFP and microcrystalline cellulose at room temperature for 1 hour to make them fully contact. Then centrifugation was performed and the supernatant was removed, and then deionised water was used to remove the unfixed residual protein. If you want to know the detailed operation, please refer to our Experimental notes and Protocols.
We observed the binding of the fusion protein containing CBM and sfGFP with microcrystalline cellulose by SEM, and measured the residual amount of the protein before and after binding by BCA method.
A variety of data indicated that CBM had strong binding ability to microcrystalline cellulose. We hope that the data results can help the subsequent iGEM team reduce the workload of verification work, and provide a new choice of immobilization matrix for the future iGEM team.
Figure 16: Scanning Electron Microscopy (SEM) analysis. A represents Microcrystalline cellulose that is not bound to any protein, B represents Microcrystalline cellulose bound to proteins containing CBM (done by Yuantest lab).
Figure 17: Protein concentration measured using BCA method. After the fusion protein containing CBM was fully contacted with microcrystalline cellulose for 1 hour, the content changes of the protein before and after adsorption were measured by the BCA method.
XJTLU-CHINA-2023 created seventeen parts, including seven new basic parts and ten new composite parts, including five new improved parts.
| Type | Part Number | Name | Length | Description |
|---|---|---|---|---|
| Basic | MSmtA4 | 168 bp | MSmtA4, a mutant protein derived from SmtA (BBa_K4968001) with four mutated sites and codon optimization, effectively enhances the adsorption capacity of heavy metals | |
| Basic | Optimized SmtA | 168 bp | SmtA, a protein belonging to the metallothionein family, and it has the ability to adsorb heavy metals and chelate these heavy metals in an inactive form. | |
| Basic | Optimized CBM | 315 bp | Carbohydrate Binding Modules (CBMs) are components of several enzymes, and their primary function is to bind to specific carbohydrates. | |
| Basic | Optimized sfGFP | 711 bp | sfGFP, a fluorescent labeling tool, does not lead to misfolding when fused with other proteins, thereby enhancing the stability of the fused protein. | |
| Baisc | Optimized CsgA | 453 bp | CsgA, a gene has remarkable ability to self-assemble into curli fiber amyloid nanofibers, optimized through codon optimization. | |
| Basic | Optimized AG4 | 39 bp | AG4, a synthetic silver-binding dodecapeptide, optimized through codon optimization. | |
| Basic | RecomSwapNeo R/Kan R | 1528 bp | The improved part of Low to medium copy Lambda Red recombineering compatible plasmid (BBa_K592202). As a Vector for Lambda Red Homologous Recombination. | |
| Tag | Optimized SUMO tag | 294 bp | Small ubiquitin-like modifiers (SUMOs) are widely used as tags for protein expression and purification. | |
| Composite | CsgA-AG4 | 510 bp | This composite part combines Optimized CsgA (BBa_K4968004) and AG4 (BBa_K4968005), containing a 6 amino acid linker. | |
| Composite | CsgC-CsgD | 1022 bp | This composite part combines CsgC (BBa_K1583001) and CsgD (BBa_K805015), containing a 38 bp nonsense sequence. | |
| Composite | CsgE-CsgF-CsgG | 1717 bp | This composite part combines CsgE (BBa_K4161013), CsgF (BBa_K4161014), and CsgG (BBa_K4161015), containing two 38 bp nonsense sequences. | |
| Composite | CsgA-Ag4-CsgC-CsgD-CsgE-CsgF-CsgG | 3293 bp | This composite part combines CsgA-AG4 (BBa_49680008), CsgC-CsgD (BBa_K4968009), and CsgE-CsgF-CsgG (BBa_K4968010), containing two 38 bp nonsense sequences. | |
| Basic | pUC_GW_Kan R | 2626 bp | As a Plasmid backbone for the part CBM-sfGFP-pUC_GW_Kan R-SUMO (BBa_K4968017). | |
| Composite | CBM-sfGFP-pUC_GW_Kan R-SUMO | 3991 bp | This composite part combines CBM (BBa_49680002), sfGFP (BBa_49680003), pUC_GW_Kan R (BBa_49680012), and SUMO (BBa_49680007). As a Vector for Gibson assembly with MSmtA4 (BBa_K4968000). | |
| Composite | SmtA-CBM-sfGFP | 1242 bp | This composite part combines SmtA (BBa_K4968001), CBM (BBa_K4968002), and sfGFP (BBa_K4968003), containing two 8 amino acid flexible linker. | |
| Composite | SUMO-SmtA-CBM-sfGFP | 1554 bp | This composite part combines SmtA (BBa_K4968001), CBM (BBa_K4968002), sfGFP (BBa_K4968003), and SUMO (BBa_K4968007), containing a 6 amino acid flexible linker and two 8 amino acid flexible linker. | |
| Composite | MSmtA4-CBM-sfGFP | 1242 bp | This composite part combines MSmtA4 (BBa_K4968000), CBM (BBa_K4968002), and sfGFP (BBa_K4968003), containing two 8 amino acid flexible linker. | |
| Composite | SUMO-MSmtA4-CBM-sfGFP | 1554 bp | This composite part combines MSmtA4 (BBa_K4968000), CBM (BBa_K4968002), sfGFP (BBa_K4968003), and SUMO (BBa_K4968007), containing a 6 amino acid flexible linker and two 8 amino acid flexible linker. |
To access the experimental results confirming the functionality of the part, please refer to our Results and Part overview main page.
We collected the information from the manuals and literature of each kit that we needed to use in our experiments, repaired, rewrote, and annotated it into a basic experimental protocol of XJTLU-iGEM 2023. See the protocol for details.
To enhance the comprehensiveness of the iGEM competition database that has already been processed, we implemented a protein-blocking system. This system consists of three interconnected tables that characterize various evolutionary pathways. Furthermore, this database can gather relevant parameters related to newly discovered proteins. Once the database reaches a sufficient level of data, we will be able to perform targeted searches for our desired proteins with specific objectives in mind.
In addition to this, we aspire to integrate artificial intelligence (AI) capabilities for protein structure analysis. This integration will enable us to extract more detailed information about the proteins we are interested in, providing greater clarity during the design phase.
In our project, we have produced a new protein complex known as CsgA-AG4. Since there is currently no available data regarding its function and properties, our research has focused on understanding its behavior through a systematic approach.
To achieve this, we collaborated with an experimental group to investigate the adsorption efficiency of CsgA-AG4. Our experiments involved varying both temperature (ranging from 4°C to 25°C) and time (ranging from 1 to 8 hours) to assess their impact on the adsorption process.
To systematically study the relationship between temperature, time, and adsorption efficiency, we employed a surface-centered design with an value of 1. This design choice allowed us to conduct experiments efficiently and systematically across a range of conditions.
Subsequently, we applied response surface analysis techniques to the experimental data. By doing so, we aimed to develop a model that would help us identify the optimal temperature and duration for achieving the highest adsorption efficiency of CsgA-AG4.
Subsequently, we applied response surface analysis techniques to the experimental data. By doing so, we aimed to develop a model that would help us identify the optimal temperature and duration for achieving the highest adsorption efficiency of CsgA-AG4.
In summary, our project involves the production and study of the novel protein complex CsgA-AG4. With no existing data on its properties, we collaborated with our experimental team to investigate its adsorption behavior across varying temperature and time conditions, utilizing an experimental setup and statistical analysis to pinpoint the optimal parameters for CsgA-AG4 adsorption.
Figure 18: The function image of time-temperature-adsorption efficiency. A represents a three-dimensional graph illustrating the adsorption efficiency as a function of temperature and time, obtained through fitting. The face center composite design (α=1) was carried out using the design expert 13. B displays a contour plot of the same function. C and D showcase interactions between temperature and time. The resulting graph is as above. 8 hours and 25℃ are proper for proteins to absorb silver ions.
Human practice is fully involved in every stage of a project's life cycle, leading and generating new ideas for the project itself, and responding to the ideas and needs of every stakeholder, to fulfill the most important needs of stakeholders within a limited time frame Human practice.
We constructed two porous devices for Claritein with silver ions affinity and with heavy metal ions. In these two devices, Claritein could adsorb silver ions and heavy metal ions. In addition, we designed two pathways for the internal circulation of wastewater in the device to allow our proteins to fully contact the wastewater. Moreover, the devices prevented proteins escape. We make continuous improvements to ensure that the devices were internal circulation and safety. More details were explained in the Hardward wiki.
This device had the porous cylindrical structure. The SUMO-MSmtA4-CBM-sfGFP would adsorb heavy metal ions in the middle of the device. Figure 19 presents the internal structure of the device. Figure 20 shows the orientation of the water flow aroud the internal structure of the device, which was depicted the blue arrow.
Figure 19: The GIF of the internal structure of the device.
Figure 20: Heavy metal ion sewage will have an internal circulation in the device to ensure that the protein is fully in contact with it.
This device deigned for silver ions adsorption. The CsgA-AG4 fusion proteins on the polycarbonate filter films were fixed between two wafers, which prevented CsgA-AG4 leakage. Every wafers had small holes to facilitate the passage of water (Figure 21). The AgNO3 solution could folw through the wafers by motor rotation. Figure 22 presents the sturcture of the adsorption of devices. Figure 23 exhibits the 3D printed piece of this hardware, inculding the display screen, access water outlet and electrical machinery.
Figure 21:: The unit has built-in temperature, pH and heavy metal ion concentration sensors. These sensors monitor the state of the effluent in real time, providing data for intelligent control of the unit. As well as a waterproof motor to keep the liquid moving to increase the reaction rate.
Figure 21: GIF of the sturcture of the adsorption of devices.
Figure 22: Figure 8: Application of protein membranes in hardware. As shown in the figure, place the prepared protein membrane with CsgA+AG4 fusion protein in the place where the protein membrane is placed, add 25 degrees 4 micromolar silver nitrate solution to the device, and monitor its concentration, temperature, and pH changes in real-time. We use the internal circulation system to circulate the water alternately clockwise and counterclockwise in the device and incubate for 8 hours to mimic the real wastewater adsorption condition.
Hammer, N. D., Schmidt, J. C., Chapman, M. R. (2007) ‘The curli nucleator protein, CsgB, contains anamyloidogenic domain that directs CsgA polymerization’ Proc. Natl. Acad. Sci. U. S. A. 104 (30)12494- 12499. Available at: https://doi.org/10.1073/pnas.0703310104
Wang, X., Hammer, N. D., Chapman, M. R. (2008) ‘The Molecular Basis of Functional Bacterial AmyloidPolymerization and Nucleation’ J. Biol. Chem. 283 (31) 21530- 21539. Available at: https://doi.org/10.1074/jbc.M800466200
Haq, F., Mahoney, M., Koropatnick, J. (2003) ‘Signaling events for metallothionein induction.’ Mutat Res. 10;533(1-2):211-26. Available at: https://doi.org/10.1016/j.mrfmmm.2003.07.014.
Saffar, B. et al. (2015) ‘Improvement of CD2+uptake ability of SMTA protein by Lys/Cys Mutation; experimental and theoretical studies’, Journal of Biomolecular Structure and Dynamics, 33(11), pp. 2347–2359. Available at: https://doi.org/10.1080/07391102.2015.1054431.
Oliveira, C. et al. (2015) ‘Recombinant CBM-fusion technology — applications overview’, Biotechnology Advances, 33(3–4), pp. 358–369. Available at: https://doi.org/10.1016/j.biotechadv.2015.02.006.
Aïssa, K. et al. (2019) ‘Functionalizing cellulose nanocrystals with click modifiable carbohydrate-binding modules’, Biomacromolecules, 20(8), pp. 3087–3093. Available at: https://doi.org/10.1021/acs.biomac.9b00646.