Culture

LB Medium

Cultivation of E.coli in experiments using LB medium (with appropriate antibiotics if needed).

The LB medium was configured as follows.

Ingredient Quantity
NaCl10 g
TRYPTONE10 g
YEAST EXTRACT5 g
ddH2OTo 1L

If formulated as a solid medium, add an additional 15 g of agar powder (1.5%) before sterilization, then autoclave the configured medium.

The preparation process is as follows.

Calculate → Weigh → Dissolve → Sterilize → Pour Plate (if needed) → Save

Detailed steps:

  1. Calculation of substance requirements based on the volume of medium required.
  2. Weigh the substances according to the calculation.
  3. Add ddH2O to fix the volume and stir well to dissolve it.
  4. Autoclave the conical vials after closing the mouth with a breathable parafilm and a leather band.
  5. In case of LB agar the inverted plate operation is carried out when the medium is cooled to about 45 ℃. The petri dish lid can be tilted to minimize condensate contamination, and the inverted plate operation is carried out in an ultra-clean bench next to an alcohol lamp.
  6. Store the liquid medium in a 4 ℃ refrigerator and use it as soon as possible. Close the solid medium with a parafilm and store it in a refrigerator at 4 ℃ and use it as soon as possible.

M9 Medium

  1. Configure of 1 mol/L MgSO4: weigh 2.46g of MgSO4-7H2O and dissolve it in 10ml of ddH2O, autoclaved it.
  2. Configure 1 mol/L CaCl2: weigh 2.191g of CaCl2-6H2O and dissolve it in 10ml of ddH2O, autoclave it.
  3. Configure 5×M9 salt solution:
Ingredient Quantity
Na2HPO4·H2O12.8 g
KH2PO43g
NaCl0.5 g
NH4Cl1g
ddH2OTo 200ml

Autoclave standby.

  1. Configure 20% glucose solution: weigh 4g glucose and dissolve it in 20ml of ddH2O, then filter with 0.22μm filter to remove bacteria.
  2. Configure M9 culture medium

Aseptic operation.

Ingredient Quantity
5×M9200ml
1M MgSO42ml
20% Glucose solution20ml
1M CaCl20.1ml
ddH2OTo 1L

Antibiotic Formulatio

The following table shows the concentration of antibiotics and working solution used, which should be diluted 1:1000 at the time of use. Note that solid media need to be added after sterilization when cooled to approximately 45 ℃ to avoid inactivation of antibiotics.

AntibioticsConcentration
Kanamycin (Aladdin,catalog number:K275316)100 mg/mL
Ampicillin (Aladdin,catalog number:A105484)100 mg/mL

The preparation process is as follows.

Calculation → Weighing → Dissolving → Dispense

Detailed steps:

  1. Calculation: according to the concentration and the required amount to calculate the antibiotic mass and sterile water volume to be weighed.
  2. Weighing: according to the calculation results.
  3. Dissolution: use a pipette gun ( the gun’s head needs to be sterilized ) to suck sterile water (ddH2O is sterilized by high-pressure steam ) and dilute to the corresponding volume.
  4. Sub-packaging: by using disposable syringe and 0.22 μM sterile syringe filter (bioshrap, catalog number: bs-pes-22 ) to filter and sub-pack the antibiotic into several 1.5/2 ml EP tubes and then store them in a - 20℃ refrigerator, and use it as soon as possible.

Inoculation

  1. All operations are performed next to the flame of the alcohol lamp on the ultra-clean bench. Sterilize both hands before handling
  2. Select the single colony to be cultured on the plate (choose the better growing single colony) and mark it.
  3. Label the conical flask with the group number, date, sample name and resistance (make sure the labeling is clear and can be traced back to the corresponding plate).
  4. Add the appropriate amount of liquid LB medium (with the appropriate antibiotic added in advance) to the sterilized conical flask.
  5. Inoculate single colonies by picking them with the sterilized tip of the pipette, which will be immersed in the medium.
  6. Place the conical flasks in a constant temperature shaker for incubation (temperature and speed depend on the appropriate experiment and purpose, e.g. 37°C and 200 rpm for routine incubation).
  7. Sterilize and irradiate the ultra-clean bench with UV light after use.
  8. OD600 was measured by Nanodrop before using the cultured bacteria.

Breed Preservation

Glycerol Stock

The E.coli used in the experiments are preserved using glycerol tube storage.

The experimental procedure for glycerol tube storage is as follows.This operation is performed next to the flame of an alcohol lamp on an ultra-clean bench.

  1. Take an appropriate amount of glycerol and deionized water, mix well in the ratio of 1:1 by volume to get 50% glycerol.
  2. Autoclave the blended 50% glycerin.
  3. Take a sterilized clean 2ml centrifugal tube, mix the bacterial solution with 50% glycerol in a 1:1 volume ratio, and then store it in a -20 ℃ refrigerator to be taken when needed.
  4. Label the centrifugal tube well, including strain name, resistance, culture medium, date and purpose.

Recovery

  1. Take the tube collection of bacteria to be resuscitated and prepare it according to the required medium and resistance, etc.
  2. Take appropriate amount of bacterial liquid for coating or streaking on the corresponding solid medium, and incubate at 37 ℃ overnight.
  3. Single colonies were picked from overnight plates and cultured for subsequent use.

Transformation

Restriction Enzyme Digestion

The desired fragment was obtained by enzymatic digestion.

The exact steps of digestion are as follows.

  1. Water bath 55℃
  2. Preparation of enzyme digestion system.

Part( Enzyme: NEB® BsmbI-v2)

Vector(Enzyme: NEB® BsmbI-v2)

50μL digestion system

Ingredient Quantity
NEBuffer™ r 3.15 μl
NEB® BsmbI-v21 μl
PlasmidX μl (≥3μg)
ddH2OTo 50 μl
  1. The reaction system was placed in a 55 ℃water bath for digestion overnight.

Notes:

*The system was added in the order of ddH2O, 3.1 buffer, plasmid, and enzyme.

*Take the ice box to get ice in advance, when using, all the materials for the preparation of the digestion system should be gotten from the left refrigerator at -20℃ and be placed on the ice.

*In experimental process, the solution should be mixed gently by mild plucking. It is forbidden to do violent shaking such as vortex, otherwise, it will cause DNA loss.

DNA Gel Electrophoresis

The corresponding fragments were obtained by agarose gel electrophoresis.

Preparation of agarose gel

Configure 1 x TAE solution for glue preparation. The specific steps for configuration are as follows.

  1. Measure 600mL of ddH2O with a measuring cylinder and place it in a beaker.
  2. Put in the stirring magnet and turn on the electromagnetic rotator.
  3. Slowly pour in 1×TAE instant granules and let it rotate automatically in the stirring magnet until its fully dissolvement.
  4. Pour the solution from the beaker into a conical flask and add the ddH2O to volume to 1 liter.

Preparation of 1% agarose gel

Small agarose gel(5 pores)

Ingredient Quantity
1 × TAE30ml
Agarose0.3g

Big agarose gel(13 pores)

Ingredient Quantity
1 × TAE100ml
Agarose1.0g
  1. Weigh the agarose gel according to the above recipe as required.
  2. After weighing the agarose gel, cover the mouth of the bottle with several layers of paper towels or parafilm to reduce the evaporation of the solution when heating, put it into the microwave oven and heat it up with high heat until boiling bubbles appear, take it out and mix it thoroughly in time, and repeat it several times until the solution is clear and transparent with no obvious particles (generally 2--3 times).
  3. When the agarose gel solution is cooled down to 50℃ (slightly hot but tolerable), add GelRed (10μL: 100mL gel solution) proportionally and shake well.
  4. Slowly pour the agarose gel solution into the gel plate and insert the comb. After complete solidification, pull out the comb vertically and place the removed gel into the electrophoresis tank. Pour enough 1×TAE solution into the electrophoresis tank to cover the gel piece by 1-2 mm.

Gel Electrophoresis

Agarose gel electrophoresis is used to separate enzyme digestion products, PCR products, and validation.

  1. The following step involves electrophoresis of the digested product.
  2. Remove the digestion product from the 55°C water bath.
  3. Preparation of blank system (unenzyme-cleaved circular plasmid) 50ul.
Ingredient Quantity
Circular plasmidXμl (1 μg)
Thermo Scientific 10X FastDigest Green Buffer1 μl
ddH2OTo 50 μl

(3) Add the sample

Load the DNA marker in the first port hole on the left.

Ingredient Quantity
DNA Marker5 μl
Enzyme cleavage system×n50 μl
Blank system×n50 μl
  1. Close to the lid of the electrophoresis tank and connect the electrodes. (Note: Black is negative, red is positive. Always run from black to red). Run at 100V first, and when the bands run out of the wells switch to 150V and continue until the end, it takes about 18 minutes.
  2. After the electrophoresis run, observe the results with UV light. Be cautious and careful during the observation process, follow laboratory safety guidelines, and minimize the amount of time the DNA is exposed to UV light, as long exposure times can lead to a higher risk of DNA denaturation.
  3. Cut off gel fragments containing the desired DNA fragments as required and store the gel fragments in a centrifuge tube at -20°C.

Gel Recovery

Gel recovery is used for direct recovery of PCR products, gel recovery of DNA fragments, and gel recovery of digested products.

DNA recovery in agarose gels

  1. The temperature of the water bath was adjusted to 65 ℃ and preheated in Eluent in advance for subsequent elution to improve the recovery efficiency.
  2. Activation of silica gel membrane was beneficial to improve the product recovery. The adsorption column was placed in a collection tube and activated by adding 250 µL of Buffer BL, centrifuged at 12,000 × g for 1 min, and the waste solution was discarded.
  3. Place the gel containing the target DNA bands into a 2 mL centrifuge tube; the gel should cut away as much of the DNA-free portion as possible and retain the portion containing DNA. Add 500 µL of Buffer GL (if the gel is too large, add Buffer GL appropriately until the solution is a pale yellow color).
  4. The centrifuge tube was placed in a 65 ℃ water bath for 4~6 min, and mixed upside down every 2~3 min until the gel was completely melted and the solution was pale yellow (if the solution was pale purple, add appropriate amount of Buffer GL until the solution turned pale yellow).
  5. The solution obtained in the previous step was transferred into the adsorption column and centrifuged at 12,000 × g for 1 min, the waste solution was discarded, and the adsorption column was put back into the empty collection tube.
  6. Add 700 µL of Buffer W2 to the adsorption column (check that the specified volume of anhydrous ethanol has been added first). of anhydrous ethanol), centrifuge at 12,000 × g for 1 min, and discard the waste liquid.
  7. Repeat step (6) once.
  8. The adsorbent column was placed back into the empty collection tube and centrifuged at 12,000 × g for 2 min.
  9. Remove the column and place it in a clean 1.5 mL centrifuge tube, add 35-50 µL of Eluent (pre-warmed at 65 ℃) to the middle of the adsorbent membrane, place it at 20-25 ℃ for 2 min, and centrifuge it at 12,000 × g for 2 min. If a larger amount of DNA is required, the resulting solution can be re-transferred to the column and centrifuged for 2 min.

Direct recovery of PCR products

  1. The water bath temperature is adjusted to 65 ℃ and the eluent is preheated in advance to improve the recovery rate of subsequent elution.
  2. Silica gel membrane activation is conducive to improving product recovery. Place the adsorption column in a collection tube, add 250 µL of buffer BL for activation, centrifuge at 12,000 × g for 1 min, and discard the waste liquid.
  3. Add Buffer GL in the ratio of PCR stock solution: Buffer GL = 1:3 (if the PCR stock solution is less than 50 µL, the amount of Buffer GL is 150 µL) in the ratio of PCR stock solution, and mix with a pipette.
  4. Add the above mixture to an activated adsorbent column and centrifuge at 12,000 × g for 1 minute. Discard the waste solution and return the column to the empty collection tube.
  5. Add 700 µL of Buffer W2 to the column (check that the specified volume of anhydrous ethanol has been added first), centrifuge at 12,000 × g for 1 minute, and discard the waste solution.
  6. Repeat step (5) once.
  7. Place the column back into the empty collection tube and centrifuge at 12,000 × g for 2 minutes.
  8. Remove the column from the adsorbent and place in a clean 1.5 mL centrifuge tube. Add 35-50 µL of eluent (preheated at 65 °C) to the center of the adsorbent membrane and allow to stand at 20-25 °C for 2 minutes, then centrifuge at 12,000 × g for 2 minutes. If larger amounts of DNA are required, the resulting solution can be transferred to the column again and centrifuged for 2 minutes.

Notes:

  • When recovering DNA fragments in the gel, a new electrophoresis buffer should be used for electrophoresis so as not to affect the electrophoresis and recovery effect.
  • If there is non-specific amplification other than the target DNA in the PCR product, it is recommended to cut the gel for recovery; direct recovery of the PCR product cannot remove the non-specific fragments.
  • The larger the elution volume, the higher the elution yield. If you need to get a high concentration of DNA, you can reduce the elution volume appropriately, but at least not less than 25 μl, the volume is too small will reduce the DNA elution rate and lower yield.
  • If the volume of the lysate is greater than 700 μL, discard the filtrate and repeat the operation until all the lysate has been filtered by crossing the absorption colum.
  • Buffer GL contains irritating solution, wear latex gloves and glasses when handling.
  • Add the specified amount of anhydrous ethanol to Buffer W2 before use (168 mL of anhydrous ethanol in 72 mL of Buffer W2), and tighten the cap promptly after each solution is used.
  • If the next step of the experiment is more demanding, it is recommended to use TAE buffer.
  • The solution was added as far as possible along the wall of the adsorption column to prevent damage to the filter membrane.After adding Buffer GW, you can turn the cap upside down and mix the solution 2-3 times to completely rinse the salts on the wall of the tube.
  • Two rinses with Buffer GW to ensure that the salt is completely removed, so as to eliminate the impact on subsequent experiments.
  • It is recommended to use high quality agarose to avoid impurities in it affecting downstream ligation and other experiments.
  • Cutting the gel into small pieces can greatly reduce the gel melting time and thus improve the recovery rate (linear DNA is easily hydrolyzed when exposed to high temperature conditions for a long time).
  • The recovered product can be tested for successful recovery by agarose gel electrophoresis or spectrophotometer. When using a spectrophotometer, it is recommended to use Eluent for calibration if Eluent is used for elution.
  • Adding 1-3 times the volume of Buffer GDP does not affect the DNA recovery rate, but make sure the gel is completely melted, otherwise the DNA recovery rate could be seriously affected.
    experiments-fig1

Gibson Assembly

We used Gibson assembly to assemble the fragments we got from recycling. The steps are as follows.

  1. Prepare Gibson Mix(2x) on ice as shown in the table below:
ComponentConcentrationVolume
T5 exonuclease1 U/μl1 μl
Phusion DNA polymerase2 U/μl0.5 μl
Taq DNA ligase400 U/μl0.25 μl
SSB protein10 mg/ml1 μl
Reaction buffer (10X)-10 μl
Deionized water-Make up to 100 μl
Total volume-100 μl
  1. Design plasmid and order primers. According to the plasmid to be constructed, determine the DNA fragments to be joined, and design complementary sequences of certain length (usually 20-40 bp) between adjacent fragments.
  2. Amplify DNA fragments by PCR. Check the size and yield of PCR products, and perform gel purification or PCR purification as needed. If using raw PCR products for assembly reaction, do not exceed 20% of the total reaction volume.
  3. Prepare assembly reaction system on ice as shown in the table below:
Component2-3 fragment assembly4-6 fragment assembly
DNA fragments to be joined0.02-0.5 pmol*0.2-1 pmol*
GibsonMix2x10 μl10 μl
Deionized waterMake up to 20 μlMake up to 20 μl
Total volume20 μl**20 μl**
  • Recommended to use 50-100 ng of vector and 2-3 fold molar excess of each insert fragment. If the insert fragment is less than 200 bp, use 5-fold molar excess. If joining more than 6 fragments, more GibsonMix2x may be required.
  • If the assembly reaction volume is larger than 20 μl, it may affect the transformation efficiency.
  1. Incubate the assembly reaction system in a thermocycler at 50°C for 15 minutes when joining 2-3 fragments or 60 minutes when joining 4-6 fragments.
  2. After incubation, store the reaction system on ice or at -20°C for subsequent transformation experiment.
  3. Transform competent cells (such as NEB 5-alpha Competent E.coli) with 2 μl of assembly reaction system, following the standard operating procedure of transformation experiment.
  4. Plate the transformed cells on agar medium containing appropriate antibiotics and incubate at 37°C until colonies form.
  5. Pick single clones from colonies, perform plasmid extraction and identification.

Verification

Protein Extraction

  1. Dilute 0.5mL of 10× Cell Lysis Buffer with deionized water to 5mL of 1× Cell Lysis Buffer.
  2. Centrifuge at 8000rpm (5700g) for 10 min to collect the host bacteria expressing the target protein, discard the supernatant and rinse the precipitate with 1×PBS buffer, and resuspend the bacterial precipitate per 100 mL of bacterial culture (at OD600=1) in 4 mL of 1× Cell Lysis Buffer.
  3. Add 40μl of PMSF and 80μl of Lysozyme to 1× Cell Lysis Buffer and incubate the bacterial suspension at 37℃ for 30 min.
  4. Incubate the mixture on a shaker for 10min.
  5. Add 20 μl of DNase/RNase and continue to incubate for 10 min at 37°C on a shaker.
  6. Transfer the samples to a freezing centrifuge and centrifuge at 5000rpm (3000g) for 30 min at 4°C to remove the precipitated insoluble material, and collect the protein supernatant into a clean test tube.
  7. Take 10 μl of each 2× SDS GelLoading Buffer and mix with 10 μl of protein supernatant and boil, and analyze the extracts by SDS-PAGE electrophoresis experiments at 10% concentration.
  8. Store the fractions containing the target proteins at -80°C or purify them directly through the purification column.

SDS-PAGE

Polyacrylamide Gel Electrophoresis (PAGE) is a method of electrophoresis in which a polyacrylamide gel is used as a support medium for the separation of proteins or nucleic acids. Polyacrylamide gel is made of acrylamide monomer (ACR) and cross-linking agent N,N-methylene bisacrylsmide (N,N-methylene bisacrylsmide abbreviated as BIS) in the role of catalyst polymerization and cross-linking of three-dimensional mesh structure of the gel. By varying the ratio of monomer concentration to cross-linking agent, gels with different pore sizes can be obtained, which can be used to separate substances with different molecular weights. We used SDS-PAGE to verify the expression of the imported proteins.

Preparation of polyacrylamide gels

  1. Installation of the gel board model: Wash the glass board, dry it and set it aside. When making glue, choose the right glass plate, assemble the glue plate model, put the glass plate into the rack after alignment, and the clamps on both sides are tightened, so that the short glass is leaning out and the long glass is leaning in.
  2. According to the following table formula configuration of the separation of the glue solution, mixing with a light hand shaking, carefully inject the mixture into the prepared glass plate gap, leaving enough space for the concentration of the glue (~ 2.5cm), gently in the top layer of the addition of 0.5ml of deionized water to cover the (liquid sealing should be slow, to avoid deformation of the glue is washed out), in order to stop the inhibition of the air oxygen on the coagulation. Just add water can be seen between the water and the gel liquid interface, and then gradually disappear, soon appeared again interface, which indicates that the gel has been polymerized. And then leave a few moments to make the polymerization complete, the whole process takes about 30 minutes (25 ℃ room temperature).
Separation gel concentrationGel volumeVolume of each component required (in ml)
H2O30%Acr-Bis (29:1)SDS-PAGE Separating Gel Buffer(4×)10%APSTEMED
6%5ml2.751.01.250.050.004
8%5ml2.421.331.250.050.003
10%5ml2.081.671.250.050.002
12%5ml1.752.01.250.050.002
15%5ml1.252.51.250.050.002
  1. The preparation of concentrated gel: the first has been polymerized to separate the upper layer of the gel water suction, and then use filter paper to absorb the residual water. Prepare the concentrated gel solution according to the following formula. Mix it and inject it into the upper end of the separation gel, insert the comb and be careful to avoid air bubbles.
  2. While the gel concentrate is being polymerized, mix the protein sample with an equal volume of 4X sample buffer, denature in a water or metal bath at 95°C for 10 min, and cool to room temperature for use.
  3. After the polymerization of concentrated gel is complete, put the gel template into the electrophoresis tank and fix it, with the small glass plate facing inward and the large glass plate facing outward, add 1X electrophoresis buffer to both the upper and lower tanks, and carefully pull out the comb, check for leakage, and remove away air bubbles at the bottom of the gel between the two glass plates.

Spiking and electrophoresis:

  1. Add 20 μul of sample to each comb well, and 5 ul of molecular weight marker to the first well to determine to protein size and to monitor the electrophoresis process.
  2. Electrophoresis: Start with a voltage of about 100 V. When the dye concentrates into a line and begins to enter the separator, increase the voltage to about 130 V. Continue electrophoresis until the dye (bromophenol blue) reaches the bottom of the gel, and disconnect the power supply.
  3. Strip the gel: remove the gel plate, gently pry open the glass plate from the bottom side, use the matching plastic knife to cut off the concentrated gel, and cut out a small corner for marking, soak into the pre-cooled electrotransfer buffer for equilibrium.

Dyeing and decolorization

  1. Fixation and staining: Remove the gel and put it into a large petri dish, stain it with Coomassie blue staining solution and fix it, preferably put it on the shaking bed and rotate it slowly for 1-2 hours.
  2. Decolorization: first wash off the dye with water, then soak in decolorizing solution, replace the decolorizing solution until the background is clear, about 4-8 hours or overnight.
  3. Photograph or dry the separated protein ribbons in the decolorized gel, or seal them indefinitely in water containing 20% glycerin in a plastic bag.
  • Coomassie Brilliant Blue R250 Staining Solution: 0.05 g of Komas Brilliant Blue R250 was dissolved in 25 mL of isopropanol, 11 mL of glacial acetic acid + H2O was added to 110 mL, and the insoluble material was removed by filtering with filter paper.
  • Decolorizing solution: 75 mL glacial acetic acid + 50 mL methanol + 875 mL H2O.

Formaldehyde Degradation Capability Verification

Determination of formaldehyde tolerance and growth curves of engineered bacteria

Fresh overnight bacterial solution was taken and inoculated into fresh medium at 1:100 and formaldehyde solution was added to the medium according to the concentration gradient set.

Controls were set up for simultaneous experiments, and bacteria containing empty carriers were taken as controls, and three sets of replications were performed for both experimental and control groups.

The OD600 of the bacterial solution was measured and recorded every hour, and the assay was continued until the OD600 reached 1.

Determination of formaldehyde degradation capacity of engineered bacteria

Formaldehyde was detected by colorimetric Nash assay during growth. During growth in 0.5 g/L yeast extract and 100 mM methanol, samples were collected by centrifugation (2 min, 14,000 rpm), and then 400 μL of the supernatant was transferred to microcentrifuge tubes. 800 μL of Nash's reagent (7.5 g ammonium acetate, 150 μL glacial acetic acid, and 100 μL acetylacetone in 50 mL of water) was added to each sample and incubated at 37 °C for 30 min, followed by measurement at 412 nm using a UV spectrophotometer.

  1. The engineered bacteria were grown overnight in M9 medium with LB and appropriate antibiotics. The next morning, 50 mL of LB medium supplemented with antibiotics was inoculated to bring the OD600 of the cells to 1. Then, a volume of 50 mL with an OD600 of 1 was isolated by centrifugation at 8000 rpm for 10 minutes at room temperature. Between these two steps, the bacteria were washed twice with water and isolated as described above.
  2. The bacterial mass was resuspended in 50 mL of standard LB medium and the actual OD600 was measured. formaldehyde solution was added at the beginning of the experiment to a final concentration of 0.5 mM.
  3. A starting sample of 600 µL was collected directly after the addition of formaldehyde, and samples were collected every 5 minutes thereafter. Samples were centrifuged at 11,000 g for 5 minutes at 4 ℃ to remove cells. A total of 500 µL of supernatant was mixed with Nash's reagent and the formaldehyde concentration was determined according to Nash's method. Throughout the experiment, the cultures were placed in a 37 ℃ oscillating water bath.

Indole Degradation Capability Verification

Determination of indole degradation capacity of engineered bacteria

The indole concentration in the bacterial solution was assayed using Kovac's reagent.

  1. Samples were taken at hourly intervals after inoculation from fresh overnight bacterial sap into new medium at a ratio of 1:100.
  2. After sampling, the bacteria were removed by centrifugation at 12,000 rpm for 1 min, and the supernatant after centrifugation was taken for detection. The modified Kovac method was used, i.e., 100 μl of Kovac's reagent was mixed with 10 μl of bacterial supernatant, and after mixing, the absorbance was measured at 571 nm.
  3. The change in indole concentration was calculated and the indole degradation curve was plotted.
  4. Simulate the working environment: centrifuge the fresh overnight bacterial solution at 8000rpm for 10min to collect the bacterial body, resuspend it with indole solubilized medium, incubate it in a shaker, and take samples for testing as above.

Determination of insatin/indigo production capacity of engineered bacteria

In our design, the engineered E.coli degrades indole to indigo red and indigo blue, respectively, by two enzymes, and we measure the two products by measuring the characteristic UV absorption peaks of indigo red and indigo blue.

  1. 1 ml of bacterial solution was taken from the reaction system that had been reacted for a certain period of time and centrifuged at 12,000 rpm for 1 minute to collect the bacterial body and supernatant.
  2. Indigo is insoluble in water and indigo red is soluble in water, at which point indigo red is dissolved in the supernatant and indigo blue is present in the precipitate.
  3. Resuspend the precipitate with DMSO to get indigo extract. Take the supernatant after centrifugation to get indigo red extract.
  4. Detect the yield of indigo red and indigo blue at 318nm and 620nm respectively.

Gene Knockout

Bacteria And Vectors

Trans10 Chemically Competent Cells were purchased from TransGen Biotech.

Plasmids pKD4, pKD46 and pCP20 were purchased from GeneStar Biotech.

Amplification Of Targeted DNA Fragments

PCR amplification of targeted DNA fragments using pKD4 as a template with knockout primers.

The PCR reaction system was as follows.

CompomentsDosage(μl)
10 μM Primer-F2
10 μM Primer-R2
2x High Fidelity PCR Master Mix25
pKD42
Total50

95°C 30s;95°C 15s;65°C 15s; 72°C 1min;GOTO2, 35 cycles;72°C 5min;12°C ∞

Primers used:

GenePrimers-FPrimers-R
frmACTATCTTAAATAGCTGAATCTATTACCATATTGAGGAAGAGCGAGAGATGTGTAGGCTGGAGCTGCTTCGTGAAGTGGACGGGGTAAACCTGCGGGAAATCAGTAACGAATTACGGTTCGATATGAATATCCTCCTTAG
pgiGCCTTATCCGGCCTACATATCGACGATGATTAACCGCGCCACGCTTTATATGTAGGCTGGAGCTGCTTCGTACAATCTTCCAAAGTCACAATTCTCAAAATCAGAAGAGTATTGCTAATGATATGAATATCCTCCTTAG
tnaATTAAACTTCTTTAAGTTTTGCGGTGAAGTGACGCAATACTTTCGGTTCGTGTCCATATGAATATCCTCCTATGGAAAACTTTAAACATCTCCCTGAACCGTTCCGCATTCGTGTTATTGAGTGTAGGCTGGAGCTGCTTC

Heat Shock Transformation

  • 1 μl pKD46 was mixed with 50 μl competent cell, ice bath for 30 min, 42°C water bath heat excitation for 60-90s, then ice bath for 2 min.
  • Add 500μL LB medium, incubate at 30°C, 200rpm for 1h.
  • Plate 100μl of culture medium on the LB-Amp plates, incubate at 30°C for 20h.
  • Confirm the growth of colonies on the plate for identification of positive clones.

Mutant Screen

Making Competent Cells for Electroporation:

  • Grow starter culture (of E.coli Top10 with pKD46) in 25mL LB-Amp medium overnight at 30°C
  • Add 500uL of overnight culture to 25mL LB-Amp
  • Grow on 30℃ shaker until OD600 = ~ 0.25 (takes ~2-3 hours)
  • Induce cultures with filtered 10% L-Arabinose, creating a final concentration of 0.1% Arabinose.
  • Place back on 30°C shaker for 1h until OD=0.6, then place on ice for 5 minutes. Start chilling centrifuge to 4°C.
  • Spin cultures @ 5000 rpm for 15 min to pellet cells.
  • Resuspend pellet in 10 mL cold water.
  • Spin @ 5000 rpm for 15 minutes, resuspend in 10 mL cold water.
  • Spin @ 5000 rpm for 15 minutes, and resuspend in cold 10% glycerol.
  • Spin @ 5000 rpm for 15 minutes and pour out the glycerol.
    • (While pouring out the glycerol pay close attention to the pellet. It is likely somewhat loose/mushy at this point, so pour off the glycerol until the pellet starts to move.)
  • Add 250μL cold 10% glycerol and resuspend.
  • Aliquot 50 μL cell suspensions into cold eppendorf tubes, store at -80°C.

Electroporation:

  • A measure of 100 μL of competent cells was mixed with 400 ng of the PCR fragment in an ice-cold 0.1 cm cuvette (Bio-Rad Inc.).
  • Cells were electroporated at 2.5 kV with 25 μF and 200Ω, immediately followed by the addition of 1 ml of LB medium.
  • After incubating for 2 h at 30℃ and 200rpm, the resuscitated susceptible state was centrifuged, 0.9 mL of the supernatant was removed, and the remaining 0.1 mL of medium was used to re-lysogenize.
  • Plate culture medium on the LB-Kan plates, incubate at 30°C for 12~16h.
  • Pick transformants.

Mutant Verification

Using identifying primers to verify the positive clones.

Primers used:

GenePrimers-FPrimers-R
frmAGCCAATCCGTTGACGACACTATTTTGCCAGCCGCCAAAG
pgiCATCGACCTGTAGGCCTGATTACGCTAACGGCACTAAAAC
tnaAGTTTTGCGGTGAAGTGACAAACATCTCCCTGAACCG

Eliminating pKD46

  • Incubating overnight at 42℃ in LB medium.
  • Plate streaking onto the LB plate and the single colonies that grew were spotted one by one respectively on the LB- Kan & Amp plates.
  • Colonies that could grow on LB-Kan plates but not on LB-Amp plates were selected as colonies that have eliminated the pKD46.

Eliminating Resistance Gene

  • Making Competent Cells for heat shock.
  • Heat shock transformation of pCP20.
  • Plate culture medium on the LB-Kan & Amp plates, incubate at 30°C overnight.
  • Pick transformants and incubate in LB medium overnight at 42℃ to eliminate pCP20.
  • Plate culture medium on the LB plate and the single colonies that grew were spotted one by one respectively on the LB plates, LB-Kan plates and LB-Kan & Amp plates.
  • Colonies that could only grow on LB plates were selected as colonies that have eliminated resistance gene.

Bacteria Immobilization

Sodium Alginate Microbeads

  1. Prepare a 2% sodium alginate solution and a 5% CaCl(2) solution, sterilize by high pressure at 121°C for 20 minutes.
  2. Add the cultured bacteria to the sterile sodium alginate solution according to a certain volume ratio, and shake with a shaker for 30 minutes to mix. Then use a pipette to suck up the mixed solution and drop it drop by drop into the CaCl(2) solution to prepare gel particles of uniform size. Place at room temperature and cross-link for 6 hours. Finally, filter and wash with sterilized physiological saline, and store at 4°C for later use.

PNIPAm Hydrogel

  1. Preparation of PNIPAm gel
  2. 90 mg of NIPAm, 5 mg Bis and 21.6 mg SDS were dissolved in 4 mL water, and then 4.8 mg of KPS initiator was added into the mixture at 65°C for 40 min under magnetic stirring to form PNIPAm microgels. Next, 0.56 g of NIPAm and 40 mL of TEMED accelerator were added into the opaque mixture in an ice-water bath. The above mixture was sealed at 5°C overnight, forming a transparent PNIPAm gel.

  3. Bacteria Immobilization
  4. For the bacteria immobilization step, the obtained PNIPAm gel was first immersed in 50 mL of 10 mM Tris-HCl buffer solution for 12 h. Then, the PNIPAm gel was taken out and put into 50 mL tris-buffer solution containing 100 mg dopamine hydro-chloride and appropriate amount of bacterial solution under stirring for 12 h until a dark gel was formed. The products were immersed into PBS for 3h and taken out. This procedure was repeated 3 times to remove excessive dopamine hydrochloride.

TOP