In the study, chemically competent E.coli Top 10 cells were used for plasmid generation. The plasmids we used are 3_Colors_ins_K2656022（http://parts.igem.org/Part:BBa_J428112）, Nickases Cas9n D10A（http://parts.igem.org/Part:BBa_J428063）, Cas_varient_dhSpCas9（http://parts.igem.org/Part:BBa_J428060） and Cas varients hSpCas9（http://parts.igem.org/Part:BBa_J428062）. A large number of plasmids were obtained after cell transfection. To better culture the cells, the cells should be plated uniformly on LB medium containing the appropriate antibiotic used in the experiment: 25 μg/mL chloramphenicol (Cm).
To introduce plasmids into E. coli Top 10 cells for further culturing, cell transfection is required. First, 10 μl of the above plasmids were added to competent E. coli Top 10 cells, after 1 minute of cultivation at 42℃, 200 μl in antibiotic-free and agar-free medium were added, and then shake at 37℃ for 45 minutes. After the end of incubation, antibiotic is added to the medium containing agar and evenly distributed into several parts, after the medium solidified, the cells were evenly applied on the dish. The cells were cultured to obtain cell suspension and incubated in a shaking incubator at 37 ℃ for no more than 16 hours. Remove and centrifuge at 4 ℃, 4000 rpm for 15 minutes to obtain the cell precipitate containing plasmid and store it in a refrigerator at -20 ℃.
An alkaline lysis method is used to purify plasmids. Using the Plasmid midi kit (E.Z.N.A®, Omega Bio-tek) to purify plasmids. Add 2.25 mL Solution I, and cells containing plasmids are resuspended using a vortex, add 2μl RNase and stop for 15 minutes. Add 2.25 mL of solution 2, gently invert the tube 8-10 times to obtain a clear mixture. Add 3.2 mL Solution III. Invert and rotate the tube gently until flocculent white precipitates form. This may require a 2-3 minute incubation at room temperature with occasional mixing. After centrifugation (4℃, 12100 rpm, 10 minutes), add the supernatant into special tube with HiBind® DNA Midi Column (only 3.5 mL at once, if the supernatant is more than 3.5 mL, then add several times), and centrifuge again (4℃, 4000 rpm, 3 minutes). Pour out the supernatant, add 3 mL of HBC buffer to the column, and after centrifugation (4 ℃, 4000 rpm, 3 minutes) pour out the supernatant. Add 3.5 ml of DNA wash buffer, and after centrifugation (4℃, 4000 rpm, 3 minutes) pour out the supernatant (this step is repeated twice). After centrifugation, the HiBind® DNA Midi Column is transferred to a 15 mL tube and dried for 5 minutes. Add 0.5 mL of Elution buffer to the dried tube and wait for 3 minutes to ensure the precipitate is evenly moistened and then centrifuge (4℃, 4000 rpm, 5 minutes). The obtained plasmid DNA is stored in the -81 ℃ environment.
In order to introduce plasmids into E. coli DH5a cells for further cultivation, cellular transfection is necessary. First, 5 µl of the above-mentioned plasmids were added to competent E. coli DH5a cells, after 1 minute of cultivation at 42℃, 200 µl were added in an environment without antibiotics and without agar, and then fluctuated at 37 ℃ for 45 minutes. After the end of incubation, antibiotics are added to the medium containing agar and evenly distributed into several parts, after the medium hardens, the cells are evenly distributed on the cup. After obtaining a large number of purified plasmids by alkaline rupture, the plasmids are injected into BL21 (DE3) cells, then the colonies are transferred to a liquid cultured liquid and gradually expand, and then the expression of IPTG-induced proteins is added.
Ni-NTA can be used to remove the relative label of the 6xHis protein. 6xHis can bind to Ni2+, which allows its protein to bind to the purified Ni-NTA mediator, and non-bound proteins are washed. In this experiment, the Ni-NTA method is used to purify the dCas9 protein and TEV protease. After centrifugation, a protein-containing supernatant is added to a test tube containing Ni-NTA-agarose, and after purification, a purified protein is obtained that does not contain the 6xHis label.
The composition of the Wash buffer and Elution Buffer required for the experiment is given in Table 1.
Table 1. Composition of Wash buffer and Elution Buffer
| Buffer Composition | |
|---|---|
| Wash buffer | Tris 20mM pH8.0, NaCl 300mM, Imidazole 10mM, Glycerine 10% |
| Elution Buffer | Tris 20mM, NaCl 200mM, Imidazole 250mM, Glycerine 10% |
Polymerase chain reaction (PCR) is an in vitro enzymatic DNA amplification reaction mediated by primers. PCR is based on the reaction of enzymatic synthesis in vitro, DNA polymerase in the presence of a DNA matrix, PCR primers, four deoxyribonucleotides (dNTP) and the corresponding Mg2+ concentration. First, the reagents specified in Table 2 were added to the test tubes (First PCR H2O and Q5 buffer were added). The mixture was divided equally into five test tubes, each of which contained 20 µl of the sample.
Tab 2. Reagents required for PCR amplification of Combo Cas, and the volume of reagents added.
| Reagents | Volume (µl) |
|---|---|
| PCR H2O | 75.6 |
| Q5 buffer | 20 |
| Q5 polymerase | 1 |
| Combo Cas forward | 0.2 |
| Combo Cas reverse | 0.2 |
| dNTP | 2 |
| DNA Template | 1 |
Then the parameters of the PCR device were set in accordance with the amplification conditions listed in Table 3. Set the temperature gradient in Step 3 to 68.0°C, 66.8°C, 64.3°C, 62.4°C, 62.0°C and place samples 1-5 from top to bottom. After the time had elapsed, 5 µl of each of all samples were added to a 2% agarose gel to obtain a graph of electrophoresis results.
Table 3. PCR system and parameters.
| Temperature | Time(s) |
|---|---|
| 98℃ | 180 |
| Cycle | |
| 98℃ | 15 |
| 62℃-68°C | 15 |
| 72℃ | 300 |
| Cycle | |
| 12℃ | ∞ |
Overlap PCR is a method that uses primers with complementary ends to form overlapping chains of PCR products so that amplification fragments from different sources can be overlapped and spliced together by lengthening the overlapping chains in a subsequent amplification reaction. In this experiment, an Overlap PCR was used to synthesize a DNA transcript template for sgRNA, i.e. four primers with overlapping sequences were connected to each other to synthesize a complete basis for the synthesis of sgRNA .First, the reagents listed in Table 4 were added to the test tubes (PCR H2O and Q5 buffer were added first).
Tab 4. Reagents required for the synthesis of the DNA transcript template, Overlap PCR was used, and the volume of reagents added.
| Reagents | Volume (µl) |
|---|---|
| PCR H2O | 69 |
| 5*Q5 buffer | 20 |
| 1mM top oligo (sgRNA-specific) (T7 FC9 sg1/sg2/sg3) | 2 |
| 1mM bottom oligo (T7 Rev-long Cas9) | 2 |
| 100mM sgRNA forward (T7 Fwd Amd) | 2 |
| 100mM sgRNA reverse (T7 Rev Amp Cas9) | 2 |
| dNTPs | 2 |
| Q5 polymerase | 1 |
Three types of top oligo were selected as the material for this PCR Overlay: T7 FC9 sg1, T7 FC9 sg2 and T7 FC9 sg3. Therefore, three separate groups of experiments were conducted, with five samples in each group.
Then the parameters of the PCR device were also set in accordance with the amplification conditions listed in Table 5. Set the temperature gradient in step 3 to 65.0°C, 63.3°C, 59.0°C, 55.7°C, 55.0°C and place samples 1-5 from top to bottom. After the time had elapsed, 5 µl of each of all samples were added to a 2% agarose gel to obtain a graph of electrophoresis results.
Table 5. System and parameters of Overlap PCR.
| Temperature | Time(s) |
|---|---|
| 98℃ | 120 |
| Cycle | |
| 98℃ | 30 |
| 55℃-65°C | 30 |
| 72℃ | 30 |
| Cycle | |
| 72℃ | 120 |
| 12℃ | ∞ |
To obtain purified sgRNA, we need to use GeneArt ™ gRNA Clean-up Kit. After the PCR Overlap, transcription is first performed in vitro. According to Table 6, the following reagents necessary for transcription are first added, respectively.
Table 6. Reagents required for sgRNA transcription and their volumes
| Reagents Volume (µl) | Volume (µl) |
|---|---|
| NTP mix (25 mM each of ATP, GTP, CTP, UTP) | 8 |
| gRNA DNA template (from PCR assembly) | 6 |
| 5X TranscriptAid ™ Reaction Buffer | 4 |
| TranscriptAid ™ Enzyme Mix | 2 |
After mixing, incubate at 37 ° C for 2-3 hours. Add 1 µl of DNase I to the reaction mixture after the transcription reaction and incubate it at 37 °C for 15 minutes. Then purify the transcribed in vitro sgRNA.
Bring the volume of the IVT reaction to 200 µl with water that does not contain nuclease, add 100 µl of buffer for binding. Mix thoroughly by pipetting. Add 300 µl of ethanol (>96%) and mix by pipetting. Transfer the mixture to a GeneJET ™ RNA purification micro-column and centrifuge for 30-60 seconds at 14,000×g. Discard the flow part. Add 700 µl of flushing buffer 1 (diluted with 13 ml>96% ethanol) and centrifuge for 30-60 seconds at 14,000 × g. Discard the running liquid. Add 700 µl of flushing buffer 2 (diluted with 30 ml>96% ethanol) and centrifuge for 30-60 seconds at 14,000 × g. Discard the flowing liquid and repeat. Centrifuge the empty cleaning column for another 60 seconds at 14,000 × g to completely remove the remaining flushing buffer, and transfer the empty cleaning column to a clean 1.5 ml centrifuge. Add 10 µl of nuclease-free water to the center of the purification column, filter and centrifuge for 60 seconds at 14,000 × g to elute sgRNA.
EcoRV HF (BioLabs®) restriction endonuclease was used to cut Nickases Cas9n D10A, Cas_varient_dhSpCas and Cas varients hSpCas9 and Eco32I (thermoscientific®) restriction endonuclease to cut the 3_Colors_ins_K2656022. The buffer that was used is rCutSmart™, 100% activity and 10X FastDigest Buffer. The following reagents were added to each of the tubes.
For Nickases Cas9n D10A, Cas_varient_dhSpCas and Cas varients hSpCas9:
| Reagents | Volume (μl) |
|---|---|
| Plasmid | 2 |
| rCutSmart™ Buffer | 1 |
| EcoRV HF | 0.2 |
| Nuclease free water | 6.8 |
For Nickases Cas9n D10A, Cas_varient_dhSpCas and Cas varients hSpCas9:
| Reagents | Volume (μl) |
|---|---|
| Plasmid | 4 |
| rCutSmart™ Buffer | 1 |
| EcoRV HF | 0.2 |
| Nuclease free water | 4.8 |
After adding all the reagents gently mix the reaction by pipetting up and down and microfuge briefly. Incubate at 37°C for 5-15 minutes and heat inactivate at 65°C for 20 minutes.
Plasmid sequences were found in iGEM's public material library, and then used Blast to select the primer sequences in the library. Two primers (VR and VF2) were finally selected for subsequent sequencing. We sent the primers together with the matching plasmids to Sangon Biotech for sequencing (see Tab1), sequenced each plasmid with two primers (VR and VF2), and compared the sequencing results with the parts sequences on the iGEM website using Blast.
Tab1. Plasmids and primers for sequencing.
| Sample | Sample Type | Resistance | Vector | Fragment length | Primer | Primer direction | Sequence |
|---|---|---|---|---|---|---|---|
| Nic D10A | Plasmid | Cm | pSB1C5C | 600bp | VR | Reverse | ATTACCGCCTTTGAGTGAGC |
| Nic D10A | Plasmid | Cm | pSB1C5C | 600bp | VF2 | Forward | TGCCACCTGACGTCTAAGAA |
| K2656022 | Plasmid | Cm | pSB1C3 | 600bp | VR | Reverse | ATTACCGCCTTTGAGTGAGC |
| K2656022 | Plasmid | Cm | pSB1C3 | 600bp | VF2 | Forward | TGCCACCTGACGTCTAAGAA |
| dhSpCas9 | Plasmid | Cm | pSB1C5C | 600bp | VR | Reverse | ATTACCGCCTTTGAGTGAGC |
| dhSpCas9 | Plasmid | Cm | pSB1C5C | 600bp | VF2 | Forward | TGCCACCTGACGTCTAAGAA |
| hSpCas9 | Plasmid | Cm | pSB1C5C | 600bp | VR | Reverse | ATTACCGCCTTTGAGTGAGC |
| hSpCas9 | Plasmid | Cm | pSB1C5C | 600bp | VF2 | Forward | TGCCACCTGACGTCTAAGAA |
In the study, chemically competent E.coli Top 10 cells were used for plasmid generation. The plasmids we used are killer red 1, killer red 2, killer red 3, killer red 4, killer red 5 and killer red B-vel. A large number of plasmids were obtained after cell transfection. To better culture the cells, the cells should be plated uniformly on LB medium containing the appropriate antibiotic used in the experiment: Ampicillin 100ng/μl.
To introduce plasmids into E. coli Top 10 cells for further culturing, cell transfection is required. First, 10 μl of the above plasmids were added to competent E. coli Top 10 cells, after 1 minute of cultivation at 42℃, 200 μl in antibiotic-free and agar-free medium were added, and then shake at 37℃ for 45 minutes. After the end of incubation, antibiotic is added to the medium containing agar and evenly distributed into several parts, after the medium solidified, the cells were evenly applied on the dish. The cells were cultured to obtain 4 ml of cell suspension and incubated in a shaking incubator at 37 ℃ for no more than 16 hours. Remove and centrifuge at 4 ℃, 4000 rpm for 15 minutes to obtain the cell precipitate containing plasmid and store it in a refrigerator at -20 ℃.
An alkaline lysis method is used to purify plasmids. Using the GenEluteTM Plasmid miniprep kit (PLN350-1KT, SIGMA) to purify plasmids.Completely resuspend the bacterial pellet with 200 μl of the Resuspension Solution and vortex the cells until homogeneous.Add 200 μl of the Lysis Solution and Immediately mix the contents by gentle inversion (6-8 times) until the mixture becomes clear and viscous. Precipitate the cell debris by adding 350 μl of the Neutralization/Binding Solution and gently invert the tube 4-6 times. Pellet the cell debris by centrifuging at 12,000rpm for 10 minutes. Add 500 μl of the Column Preparation Solution to each miniprep column (GenElute Miniprep Binding Column+microcentrifuge tube) and centrifuge at 12,000rpm for 1 minute. Discard the flow-through liquid.Transfer the cleared lysate to the miniprep column and centrifuge at 12,000rpm for 1 minute. Discard the flow-through liquid. Add 750 μl of the diluted Wash Solution to the column and centrifuge at 12,000rpm for 1 minute.The column wash step removes residual salt and other contaminants introduced during the column load. Discard the flow-through liquid and centrifuge again at maximum speed for 2 minutes.Transfer the column to a fresh collection tube.Add 100μl of Elution Solution and wait for 3 minutes to ensure the precipitate is evenly moistened and then centrifuge (4℃, 4000 rpm, 5 minutes). The obtained plasmid DNA is stored in -81 ℃ environment.