1.  Overview

Light controlled switches regulate gene expression, which is an important tool in synthetic biology, targeted therapy of diseases and other fields. Based on the discipline of optogenetics, light-sensitive cellular proteins can be engineered to act as switches, thus promoting the efficiency of "insulin switch".

Cryptochrome 2, a blue light receptor found in Arabidopsis, is a blue/ultraviolet light receptor that can bind to CIB1 to regulate downstream signaling (primarily the expression of genes). Another protein, BIC (blue light inhibitors of cryptochrome), can bind to CRY2 to inhibit its light activation, but the inhibition speed has proven to be rather low. By fusing the UV receptor UVR8 and BIC for expression, a much more rapid "off" switch can be realized under UV light conditions.

The experiment flow chart can be shown as follow (Fig.1).

 

2.  Cycle1 pBridge-BD-CRY2(UVR8-BIC2) （ Part ： BBa_K4874004 ）  Plasmid Construction

2.1 Design

To construct the plasmid pBridge-BD-CRY2(UVR8-BIC2), we selected TRP as the promoter, PGK1 as the terminator of UVR8-BIC2; ADH1 as the promoter, and ADH1 as the terminator of CRY2 within the plasmids. Key genes of the plasmids include UVR8N397 and BIC2 genes. The TRP, PGK1 and UVR8N397 DNA fragments were amplified by PCR. Then we performed homologous recombination to link the 3 DNA fragments to the linear pBridge-BD-CRY2 vector digested by double enzyme.

A schematic diagram of the plasmid construction can be shown as follow (Fig.2).

 

2.2 Build

2.2.1 Amplification of the three DNA fragments and double enzyme digestion of plasmid

TRP1 promoter PCR amplification 134bp

TRP-Forward Primers: CATCCATACAATGGGCCATATGAATTCGGTCGAAAAAAG

TRP-Reverse Primers: CCTCCGCCATACTCCAAGCTGCCTTTGTG

TRP1 Template: pBridge plasmid

 

UVR8N397 PCR amplification 1213bp

UVR8-Forward Primers: CAGCTTGGAGTATGGCGGAGGATATGGCTG

UVR8-Reverse Primers: GTGTTCTTCATCCCTGAAGATGGATCGATA

UVR8 Template: UVR8 plasmid template

 

BIC2 PCR amplification 384bp

BIC-Forward Primers: CATCTTCAGGGATGAAGAACACCAATTTGCC

BIC-Reverse Primers: GGATAGCTAGAAGCCATATGTCAACAAGAACTCTCAAC

BIC2 Template: Arabidopsis genome DNA

  

Restriction endonuclease single digestion

pBridge-BD-CRYN489——Nde1

 

The DNA fragments of the TRP promoter, UVR8N397, and BIC were successfully amplified. These can all be seen from the gel map below (Fig.3.2).

The electrophoretic strip of the TRP promoter fell between 100 bp to 250 bp, which matched the designed length of 134 bp (Fig.3.2).

The electrophoretic strip of the UVR8N397 fell between 1000 bp to 2000 bp, which matched the designed length of 1213 bp (Fig.3.2).

The electrophoretic strip of the BIC fell between 250 bp to 750 bp, which matched the designed length of 384 bp (Fig.3.2).

Nde1 enzyme cut results

The electrophoretic strip of pBridge-BD-CRY2 (Nde1 single digestion) falls above or around 7500 bp, which matches the designed length of 8361 bp (Fig.3.2).

Figure 3.1 Nde1 digestion

Figure 3.2 DNA fragment amplification

 

Homologous recombination 1731bp

Linearized vector, TRP1 product, UVR8 product, BIC2 product

 

2.2.2 Transformation

DH5a Competent Cell

Figure 4. Result of transformation with the linearized vector （Nde I digested） and the three DNA fragments.

 

2.2.3 Determination by Colony PCR and sequencing

The length after colony PCR should be the sum of TRP UVR8 and BIC2, which equals 1731 bp. On plate 1, electrophoretic strips 2,3, and 4 are successful and on plate 2, electrophoretic strips 1,3, and 5 are successful. (Fig.5) We use length to determine if three fragments connect. And the bright band is a primer dimer.

Figure 5. Colony PCR results.

 

 

Figure 6. The sequence data of the recombinant plasmid pBridge-BD-CRY2(UVR8-BIC2).

We picked our single colony and sent them to company for DNA sequencing, the final results indicated that there were not genetic mutations on our genes and the recombinant plasmid in lane 4 of plate 1 was successfully constructed validated by sanger sequencing (Fig.6).

 

2.3 Test

Transformation

The homologous recombination plasmids of pBridge-AD-CIB1, pBridge-BD-CRY2 and UVR8-BIC2 were transferred into AH109.

Culture

We used SD double deficient medium, and yeast without inserted DNA fragments lacked Leucine and Tryptophan, making it unable to grow. However, yeast that successfully inserted fragments can grow, thereby achieving the goal of expanding culture. Transferring the plasmid into yeast can maintain a stable structure.

Functional test

Our goal is to examine the whether a greater efficiency of the “off” switch can be achieved under UV conditions with the insertion of UVR8 fragments, and whether UVR8 genes can work under UV with extra light conditions (dark or blue light). To visualize the results, we designed the detection of β galactosidase activity. Essentially, the quick “off” characteristic of UVR8 can be verified if the enzymatic activity shows a rapid decrease trend, vice versa.

Therefore, we set four different light conditions: dark, dark with UV, blue light, and blue light with UV, and observed different performances of yeast cells with plasmids transformed.

 

Table 1 Experimental design form for β galactosidase activity detection and expected outcomes.

 

As indicated in the experimental design form, the variable between experimental group 1 and 2 is the UVR8 gene. The variable between light condition 1 and 2 (3 and 4) is the UV light. The variable between light condition 2 and 4 is the light condition besides UV light. The expected outcome of each condition is outlined in the design form (Table.1).

 

 

Figure 7. Bar chart and line chart of β-galactosidase (β-GAL) activity assay.

 

As indicated in the experimental design form, the variable between experimental group 1 and 2 is the UVR8 gene. The variable between light condition 1 and 2 (3 and 4) is the UV light. The variable between light condition 2 and 4 is the light condition besides UV light. The expected outcome of each condition is outlined in the design form (Table.1).

 

2.4 Learn

 In the process of constructing plasmids, we should pay attention to the steps of extraction after gelation, increase the concentration of enzyme digestion and insertion fragments, and extract plasmids.

 In this cycle, we learned how to visualize our results from intrinsic gene regulation to extrinsic enzymatic activity based on a series of positive correlations: how absorbance levels reflect the activity of β galactosidase, how activity levels of β- galactosidase reflect the availability of BD-CRY2-UVR8-BIC2 on/off switches, and how the working patterns of on/off switches reinforce or invalidate our original assumptions.

3.  Cycle 2 Detection of β Galactosidase Activity

3.1 Design

In order to confirm whether the blue-light dependent CRY2/CIB2 system works, we performed yeast transformation of AD-CIB1 and BD-CRY2. We got these two plasmids from a company.

 

3.2 Build

The plasmids were transformed into E.coli DH5a to get more. Then pBridge-AD-CIB1 and pBridge-BD-CRY2 were transformed into AH109.

3.3 Test

Because SD medium is a double deficient enzyme medium, yeast without AD and BD implantation cannot grow, so white colonies are positive colonies.

Figure 8. Yeast culture results in medium SD/-Leu/-Trp.

3.4 Learn

 We learned that CRY2/CIB1 system could work. And compared with BD-CRY2-UVR8-BIC2 on/off switches system, it could not regulate the off by self. In conclusion, our BD-CRY2-UVR8-BIC2 on/off switches system could increase the rate of “off”.