Protocols

1 Vector construction

1.1 Selection of sgRNA targets

The appropriate sgRNA targets for the interest gene will be selected using the online sgRNA design tools. The following are some web-based sites for the selection of sgRNA targets:

1. http://www.plantsignal.cn/CRISPR/crispr_primer_designer.html
2. http://www.genome-engineering.org/crispr/?page_id=41
3. https://www.dna20.com/eCommerce/cas9/input
4. http://www.genome.arizona.edu/crispr/index.html

Alternatively, sgRNAs can be designed manually. In principle, the specificity of the Cas9 nuclease is determined by the 20-nt guide sequence within the sgRNA. A potential target sequence must immediately precede a PAM (50-NGG-30) to be recognized by the first 20-nt of sgRNA via Watson–Crick base pairing. The recognition between sgRNA and its target will lead to Cas9 cleavage *3 bp upstream from the PAM.

1.2 Design of the gRNA oligonucleotides

Once a 20-nt target site is selected, a pair of DNA oligos

can be synthesized as follows,

Forward oligo: 5’-gattGNNNNNNNNNNNNNNNNNNNN-3’

Reverse oligo: 5’-aaacNNNNNNNNNNNNNNNNNNNNC-3’

Here the successive ‘‘N’’s in the forward oligo correspond to the 50 20-nt preceding the PAM (50-NGG-30) and those in the reverse oligo are just the reverse complementary sequence. Note that the PAM sequence is not included in the oligos. For seamless ligation of the synthesized DNA oligos to the sgRNA backbone vector, psgR-Cas9-At (Supporting Information), two adapters were added to the 5’ of both oligos to generate a 20-bp oligo duplex with 4-nt overhangs at both ends after annealing. Since the resulting overhangs are compatible with the two BbsI sites in psgR-Cas9-At, the annealed oligos can be ligated into the sgRNA-Cas9 cassette seamlessly.

1.3 Construction of the backbone vector

1. Phosphorylate and anneal each pair of oligos.
2. Digest 0.5 lg of psgR-Cas9-At with BbsI for at least 2 h at 37 ºC.
3. Ligate the BbsI-digested vector with the oligo duplex.
4. Transform E. coli with the ligation product

5. Identify positive clones by colony PCR

   (Note: The specific experimental steps can be referred to Liu WS et al., 2015)

1.4 Construction of the pant expression backbone vector

1. Digest the pCAMBIA1301S vector and the backbone vector with HindIII and EcoRI in separate reactions at 37 ºC for 2 h
2. Run the reactions on a 1 % agarose gel, cut the digested band of the backbone vector and the band of linearized pCAMBIA1301S
3. Set up the ligation reaction incubate at 16 ºC for 2 h
4. Transform the ligation reaction into DH5 alpha competent cells and plate cells on LB plates containing 50 lg/mL kanamycin for selection in this case
5. Identify positive clones by colony PCR

6. Purify plasmid from the culture of the positive clones

   (Note: The specific experimental steps can be referred to Liu WS et al., 2015)

Reference:

Liu WS, Zhu XH, Lei MG et al. (2015) A detailed procedure for CRISPR/Cas9-mediated gene editing in Arabidopsis thaliana. Sci. Bull., 60(15): 1332–1347.

1.5 Preparation of Escherichia coli competent cells

1. Incubate one droplet E. Coli XL-1-Blue in 150 ml LB plus 150 μl Tetracycline (10 mg/ml) overnight without shaking at 37∞C
2. Place the culture into three 50 ml falcon tubes and chill on ice for at least 2 h
3. Centrifuge the culture at 4000 g for 5 min at 4∞C (4800 rpm Heraeus Megafuge 1.0R, rotor 3360)
4. Discard the supernatant
5. Gently resuspend the cells of each tube in 25 ml of an ice-cold, sterile competent cell solution
6. Place the cell suspension in an ice bath for 15 min
7. Centrifuge the suspension at 4000 g for 5 min at 4∞C
8. Discard supernatants
9. Resuspend the cells of each tube in 3.3 ml of an ice-cold, sterile competent cell storage solution
10. Dispense 0.2 ml aliquots into tubes and freeze immediately in liquid nitrogen. Make ~50 tubes
11. Store at -80°C

1.6 E. coli transformation with plasmid

(1) Things required:

1. -80°C competent cells of E. coli
2. 10 μl plasmid DNA
3. ice, water bath at 37°C, 42°C
4. LB liquid medium
5. LB solid plates with antibiotic

(2) Steps:

1. Thaw the E.coli cells on ice
2. Add the DNA 10 μl in the tube, mix carefully
3. Place it on ice for 45 min
4. Place in a water bath at 42°C for 1-2 min
5. Put it on ice for 5 min
6. Add 800 μl LB medium
7. Leave in a water bath at 37°C for 60 min
8. Prepare agar plates with different numbers of bacteria: e. g. place 5 μl onto one dish, 50 μl onto another and 500 μl onto another, better use 50 μl/plate
9. Spread bacteria over each dish evenly using a sterile glass spreader
10. Incubate the dish upside down in an incubator at 37°C overnight until bacterial colonies are visible by eye

2 Genetic transformation system of sweet potato

2.1 Preparation of sweet potato aseptic tube seedlings:

1. Take a 5cm long sweet potato stem tip, clean it with dishwashing liquid, and wash it with running water several times
2. Cut a 2 cm long stem tip, disinfect with 75% ethanol for 90 seconds, and flush with sterile water three times
3. Disinfect with 3% sodium hypochlorite solution for 10 minutes, flush with sterile water five to six times
4. Use sterile filter paper to absorb the surface moisture of the sweet potato stem tip, and inoculate the sweet potato stem tip on MS medium
5. Subculture the obtained aseptic seedlings in large numbers for germplasm preservation and inducing callus induction materials.

2.2 Induction of embryogenic calli

1. Under a microscope, peel off the approximately 0.5mm long sweet potato stem tip meristematic tissue, inoculate it on MSD induction medium, and after culturing at 25℃ with light for 4-6 weeks, it can be induced into embryos
2. The induced embryos can be subcultured onto a new MSD medium for preservation, with monthly subculturing once, while removing non-embryonic callus to purify the embryos.
3. The embryos are continuously purified and expanded for preservation and providing suspension culture materials

2.3 Suspension culture of embryogenic callus

1. Transfer the embryogenic callus cultured on MSD medium to small cell masses using a 0.5mm pore size sieve, transfer them to a triangular bottle containing 35ml of LCP suspension culture medium on a shaker, and suspend culture it.
2. Subculture once a week (i.e., change the culture solution once a week) under the conditions of 30℃ and shaking at 120 rpm

3 Agrobacterium-mediated transformation

3.1 Preparation of competent cells

1. Take the -70℃ frozen pseudomonas aeruginosa LB4404 and streak it on a plate containing 50μg/ml streptomycin, culturing at 28℃
2. Pick single colonies and inoculate them into 5ml YM liquid medium, shake flask culture at 220 rpm at 28℃ for 12-16 hours
3. Take 2 ml of bacterial liquid and transfer it into 100ml YM liquid medium, shake flask culture at 28℃ at 220 rpm until the OD600 reaches 0.5.
4. Transfer into a sterile centrifuge tube, centrifuge at 5000 rpm for 5 minutes, and remove the supernatant
5. Add 10 ml of pre-cooled 0.1M CaCl2 solution, gently resuspend the cells, and keep ice for 20 minutes. Centrifuge at 4℃ at 5000 rpm for 5 minutes and remove the supernatant
6. Add 4ml of pre-cooled CaCl2 solution containing 15% glycerol at 0.1M, gently resuspend.
7. The Agrobacterium suspension is aliquoted into sterile Eppendorf tubes with 200μl per tube and stored at -70℃

3.2 Transformation of Agrobacterium ssp. by freeze-thaw

(1) Materials

1. YEB medium with MgSO4 (2 ml of 1 M per liter YEB) or AB medium
2. 10% glycerol (in water)
3. iii.liquid nitrogen
4. electroporation cuvettes (electrode distance = 0.2 cm)
5. v.Gene pulser
6. YEB + 1.5% agar plates + antibiotics (or LB)

(2) Production of competent Agrobacterium cells

1. Set up an o/n culture of Agrobacterium in 10-20 ml YEB + antibiotics (28°C shaking).
2. Centrifuge for 20 min at 3000g at 4°C (4000 rpm Heraeus Megafuge 1.0R, rotor 3360).
3. Discard the supernatant
4. Wash in the same culture volume of 10% glycerol and centrifuge for 20 min at 3000g at 4°C
5. Discard supernatant and repeat the washing step
6. Decant most of the 10% glycerol supernatant and, by vertexing, resuspend the cells in the remaining ½ x 10-2 volume (i.e., 200 μl if the culture was in 10 ml of medium).
7. Make 50 μl aliquots and use for electroporation or freeze in liquid nitrogen and store at –80°C

(3) Freeze-thaw transformation

1. Thaw competent Agrobacterium on ice (use 250 µl per transformation reaction), and add DNA (10 µl of standard E. coli mini-prep DNA or 1-5 µg of CsCl-purified DNA).
2. Keep the mixture on ice for 5 minutes
3. Wearing eye protection and gloves, transfer to liquid nitrogen for 5 minutes.
4. Wearing eye protection and gloves and using forceps, remove the tubes from liquid nitrogen and incubate the mixture for an additional 5 minutes in a 37 ºC water bath
5. Add 1 ml of LB to each tube, seal well, and place the tubes on a rocking table for 2-4 hours at room temperature
6. Collect the cells by spinning briefly in a micro-centrifuge, and spread them on one LB agar plates containing the appropriate antibiotic. Include the appropriate antibiotic for the T-DNA vector
7. Incubate the cells for 2 days at 28 °C

3.3 Agrobacterium infection of sweet potato callus

1. Choose positive LBA4404 agrobacterium single colony and clone it in 15ml YEB (with specific antibiotic). Cultivate under 28°C, 200 rpm overnight
2. Inoculate the bacteria into YEB in the proportion of 1:50 under 28℃, 200 rpm overnight. Monitor the OD600 to be between 0.5-1.0
3. Transfer the prepared bacteria solution in sterile covered-centrifuge tubes. Centrifuge at 6000 rpm, 4°C for 10 minutes
4. Remove the supernatant. Add 50ml MS liquid medium (pH5.3), centrifuge it at 6000 rpm, 4°C to clean it
5. Use 20 ml MS liquid medium (pH5.3 with 200 μM AS) to suspend the bacteria, and adjust the OD600 to about 1.0
6. Carry out the resuspension of the bacteria solution under 28℃, 100 rpm for 1-2 hours in the shaker
7. While waiting for the resuspension time, prepare the sweet potato suspension cells, which means to remove the nutrient solution from the solution and clean the callus with fresh medium
8. Use the resuspension of the bacteria solution said before to immerse the suspension cells. Make it vacuum for 10-20 minutes
9. Place a layer of sterile filter paper on the co-culture medium (containing 200μM AS). After blotting up the bacteria fluid on the callus, transfer the callus to the center of the filter paper. Spread it out from inside to outside. Leave it blank at the margin besides the filter paper (0.5cm). Cultivate it for 3 days at 25℃ with light intensity of 16L/8D
10. Use sterile water to wash the co-cultivated callus for more than three times, then use fresh sterile water (containing 200 mg/L cefotaxime) to clean for more than two times. Try to make the agrobacterium as clean as possible. At the same time, choose part of the callus to carry out the transient expression of the GUS gene
11. Transfer the callus to the screening medium (containing 20 mg/L Hyg and 200 mg/L cefotaxime) and cultivate it under 25℃ with light intensity of 16L/8D
12. After 2-6 weeks, transfer the resistant callus tissue or embryoid which are still alive on the medium to a fresh medium and continuous regeneration. The embryoid will become mature gradually, and finally grow into multiple shoots and plantlets

4 Verification of the transgenic plants

4.1 GUS detection of the transgenic plants

Steps:

1. Use distilled water to dilute the 50X GUS mother liquor and configure it into 1X GUS dye liquor
2. Sampling the blade
3. Put the blade inside the hole of the six-well plate
4. Add GUS dye liquor to each of the six wells, make the liquor completely cover the blades
5. Use aluminum foil to enclose it carefully, to protect it from the light
6. Put the plate in a shaker
7. Observe color change
8. Draw out the dye and add ethanol, stop dying it and make the chlorophyll fade
9. Use a stereo microscope to observe and take photos

4.2 DNA Extraction of the transgenic plants

1. Weigh and take an appropriate amount of transgenic plantlet blades. Put them in centrifuge tubes with small steel balls. Add liquid nitrogen and ground the sample on the ball mill
2. Add 600μl buffer GPS and 20μl Proteinase K to the centrifuge tubes, mixing it rapidly, then put it into a water bath at 65℃ for 15 minutes. During water bathing, invert the tube from time to time to mix the sample
3. Add 150μl buffer GPA, mix completely, then put it at indoor temperature after taking ice-bath for 5 minutes
4. Centrifuge all tubes with samples for 5 minutes at 12000 rpm
5. During centrifugation, use a pipette to draw the liquid that has been mixed in advance into holes of a 96-deep-hole plate, and add 450μl isopropanol and 10μl RNase A (10mg/ml).
6. Remove the supernatant and pick 450μl sample into holes prepared in last step to extract the DNA

4.3 PCR verification for the transgenic plantlets

1. Design two primers separate according to the protein gene of Cas9 and the resistance gene of hygromycin (HygR)

   • CAS9-F：GACAAGAAGTACAGCATCGG
   • CAS9-R：AGCTGAGACAGGTCGATC
   • HygR-F：ATGAAAAAGCCTGAACTCAC
   • HygR-R：CTATTTCTTTGCCCTCGGAC

2. 2Use Vazyme® 2 × Taq Master Mix (Dye Plus) and the designed primer F and R to amplify the target gene. The reaction system for PCR is shown as followed (10μl):

   • 2 × Taq Master Mix 5μL
   • Primer F 0.5μL（10 pmol）
   • Primer R 0.5μL（10 pmol）
   • Template Transgenic plantlet DNA
   • ddH2O 4μL（To 10 μL）

3. The reaction of PCR. Conditions:

   • i.Pre-denaturation: 95°C, 3 min;

   • 30 cycles:

     Denaturation: 95°C, 30 s; Annealing: 55°C, 1 min; Extend: 72°C, 1 min

   • Thoroughly extend: 72°C, 5 min;
   • Heat preservation: 16°C

5 Starch detection of transgenic sweet potato

5.1 Preparation of sweet potato root powder

1. Wash, peel and cut freshly harvested sweet potato roots into small pieces.
2. Put the cut sweet potato chips into the wall breaker and add the appropriate amount of water

5.2 Extraction of sweet potato root starch

1. Wash, peel and cut freshly harvested sweet potato roots into small pieces
2. Put the cut sweet potato chips into the wall breaker and add the appropriate amount of water
3. Wash, peel and cut freshly harvested sweet potato roots into small pieces
4. Put the cut sweet potato chips into the wall breaker and add the appropriate amount of water
5. Set the wall breaker to the mode of fruit and vegetable juice and extract it for 30 min
6. Divide the extracted sweet potato juice into several bottles and let stand
7. Wait until the starch particles in the sweet potato juice settle to the bottom, pour off the supernatant liquid, add water and shake well
8. Let stand for 24 hours, then drain the water and let it air dry
9. After the water evaporates, use the mortar to grind the starch into powder, put it into a 15 mL centrifuge tube, and store it in the dehumidification cabinet until use

5.3 Detection of starch by iodine staining

(1) Preparation of iodine solution

1. Weigh 2.00g potassium iodide and add appropriate amount of distilled water to dissolve fully. To form a saturated solution
2. Add 0.20 g of iodine, after all iodine dissolved, the solution was fixed to 100 ml, shake well
3. Put it away from light and wait for use

(2) Sample determination

1. Take 1 mL of temporary iodine solution and dilute it 5-7 times with distilled water.
2. Dip a small amount of prepared dried starch into a glass slide with a spoon, add 2 drops of diluted iodine solution, and cover the glass slide
3. Specimens were observed under an optical microscope with a 40x objective.

5.4 Content determination of total starch

1. Weigh about 0.1g of the sample, grind it in a mortar, add 1mL reagent 1, fully homogenize it, transfer it to an EP tube, and extract it in an 80℃ water bath for 30 min
2. Centrifuge at 3000 g and room temperature for 5 min
3. Discard the supernatant, leave the precipitation, add 0.5 mL of double steaming water to the precipitation, and put it into a boiling water bath for pasting for 15 min (cover tightly to prevent water loss)
4. After cooling, 0.35 mL reagent 2 was added and extracted at room temperature for 15 min (3-5 times of intermediate oscillation)
5. Add 0.85mL double steaming water, mix well, centrifuge at room temperature for 3000 g for 10 min, and take the supernatant.
6. After taking 100 μL supernatant and adding 700 μL distilled water, the eight-fold dilution determination was performed. (Note: If the absorbance of the sample after 8-fold dilution is greater than 1.5 or less than 0.1, it is recommended to measure the sample after appropriate dilution or concentration.)
7. The spectrophotometer was preheated for more than 30 min, the wavelength was adjusted to 620 nm, and the distilled water was zeroized. At the same time adjust the water bath to 95℃
8. Determination of standard product: 0.2mL standard solution (distilled water as blank) and 1mL working liquid were put into EP tube, bathed in water at 95℃ for 10 min (tightly covered to prevent water loss), cooled to room temperature naturally, and absorbance value A standard and A blank were determined at 620 nm wavelength. Calculation: ΔA=A standard -A blank
9. Sample determination: Take 0.2mL sample and 1mL working liquid into EP tube, bathe in water at 95℃ for 10 min (cover tightly to prevent water loss), cool to room temperature naturally, and measure absorbance at 620 nm wavelength. ΔA´=A determination - A blank

5.5 Determination of amylose content

1. Accurately weigh about 10 mg of dried sweet potato starch, moisten it with 100 µL 95% ethanol, add 900 µl 1mol/L NaOH, and heat it in a boiling water bath for 10 min.
2. After cooling, use distilled water to form a 10mL solution
3. 500 µL sample diluent was absorbed into 15 mL centrifuge tubes and 100 µL of 1 mol/L HAC was added for acidification. Add 200µL of iodine solution, volume with distilled water to 10 mL, and leave for 10 min away from light.
4. A blank control was prepared with 0.09 mol/L NaOH as a substitute sample, and the absorption value was determined with a 1 cm colorimetric cup at 620 nm (i.e., OD620 value)
5. Plug the OD620 values into the standard curve and quantify the amylose content

6 Appendix:

Preparation of medium

1 Medium ingredients

1. LB medium:

   Tryptone	10.00 g/L
   Yeast extract	5.00 g/L
   NaCl	10.00 g/L
   pH	7
   Agar (only for solid medium)	15.00 g/L

2. TY medium

   Tryptone	5.00 g/L
   Yeast extract	3.00 g/L
   CaCl2	1.11 g/L
   pH	7
   Agar (only for solid medium)	15.00 g/L

3. YEB medium

   Tryptone	5.00 g/L
   Yeast extract	1.00 g/L
   Beef extract	5.00 g/L
   sucrose	5.00 g/L
   MgSO4	0.496 g/L
   pH	7.4
   Agar (only for solid medium)	15.00 g/L

4. MS medium

   MS medium powder (with vitamins)(Phyto Technology Laboratories™)	4.43 g/L
   Sucrose	30.00 g/L
   pH	5.3
   Gelrite (only for solid medium)	15.00 g/L

5. BBM medium

   MS medium powder (with vitamins)(Phyto Technology Laboratories™)	4.43 g/L
   Sucrose	30.00 g/L
   pH	5.8
   Gelrite	3.00 g/L

6. MSD medium

   MS medium powder (with vitamins)(Phyto Technology Laboratories™)	4.43 g/L
   Sucrose	20.00 g/L
   2, 4-D stock (2 mg/ml)	1.00 ml/L
   pH	5.8
   Gelrite	3.00 g/L

7. LCP medium

   MS medium powder (with vitamins)(Phyto Technology Laboratories™)	4.43 g/L
   Sucrose	40.00 g/L
   KCl	2.20 g/L
   2, 4-D stock (2 mg/ml)	1.00 ml/L
   pH	5.8

2 Step examples of medium preparation

(1) LB medium:

1. Weigh the reagents accordingly and add them to a glass beaker and make up the volume to 90% of planned with ddH2O
2. Dissolve the components in the beaker using a magnetic stirrer
3. Adjust the broth to the final volume using ddH2O and adjust the pH to around 7.4
4. Aliquot and transfer the broth to conical flasks
5. Add agar if planned to make a solid medium
6. Close the mouth of the flasks and place the bottles into the autoclave for sterilization under 121°C for 20 min
7. Cool the sterilized broth without agar to room temperature for use as liquid medium and cool the sterilized broth with agar around 50 °C to make solid medium plates
8. On the ultra-clean Workbench, add sterilized stock solutions of antibiotics accordingly into the broth with agar when it is cooled to around 50 °C (or into the broth without agar before use) and mix well
9. Make solid medium plates

(2) TY medium

1. Prepare stock solution of CaCl2 with concentration of 1 M.
2. Carry out the preliminary work in the same procedure as steps a) – g) for LB medium preparation
3. On the ultra-clean Workbench, add sterilized stock solutions of CaCl2 and antibiotics accordingly into the broth with agar when it is cooled to around 50 °C (or into the broth without agar before use) and mix well
4. Make solid medium plates

(3) MS medium

Carry out the preliminary work in the same procedure as that for LB medium preparation.