First Iteration of the Engineering Cycle
Research and Design
Our project primarily functions based on being able to use the functional epitopes of the tyrosine-rich oocyst wall protein (TrOWP2) derived from Toxoplasma Gondii to produce an immunological response from the cat, thus preventing future toxoplasmosis and reducing shedding of the parasite into the environment. The peptides that comprise linear B-cell epitopes can be used in place of antigens when producing antibody responses via immunization. As such, we can attach an epitope peptide sequence to our phage-based vaccine in order to effectively immunize the cat. To better understand and determine the locations of these epitopes, we used several web-based software in order to predict, as well as visualize the location of the antigen’s epitope region. We also found other antigen sequences through literature review and selected the two antigens with the highest levels of antigenicity.
Using the newfound sequence FKCAEGTTETIDGDCKRLKQFPP, Alpha Fold via the collabfold web server was used to produce 3D protein models that we could then use for additional analysis of the epitope’s properties based on the structure. With these models, we predicted the epitope sequence to be TTTAAATGTGCCGAAGGAACAACGGAGACTATTGACGGTGACTGCAAGCGCTTGAAGCAGTTTCCGCCA. This became our part BBa_K4734005. The other two epitope sequences were TNNEDEQ (which became our part BBa_K4734003) and QGNDEHSSQ (which became our part BBa_K4734004). We found the DNA sequences of these through literature review.
We selected the phage M13 to perform our peptide display with; we needed to design primers to amplify the M13 vector. We used Benchling to design two sets of primers. We made one of our sets of primers into parts. Our forward primer from that set became the part BBa_K4734001 and our reverse primer from that set became the part BBa_K4734002.
Build
We performed a PCR with our template DNA with each set of primers we designed in order to linearize our vector, so that we may insert our epitope into the vector. This leads to the M13KE Phage being able to present the phage and the epitope attached to it so that it can penetrate through the mucus layer and epithelial cells to the lymph in order to produce an immune response. Then, we performed gel electrophoresis on each sample to determine if we had DNA of the correct size. After confirming our vector was around 7 kb as expected, we annealed our 3 antigen insert sequences and ligated them to our vector in separate samples.
Test
We did a gel test on the ligated pieces in order to see if the piece was ligated properly. We found no bands on our DNA gel, confirming there was an error in our ligation step.
Learn
We rationalized that the lack of band presence was due to a mistake in our ligation or plasmid linearizing step. We recognized some issues with our PCR protocol, which we discuss further in the next section. We also note that the frequent inaccuracies in blunt-end ligation could have also been a key factor in the failure of our ligation.
Second Iteration of the Engineering Cycle
Research and Design
We used Benchling to design our primers. We chose sequences on either side of the site of insertion that were an agreeable length, between about 20 and 30 base pairs, and had matching annealing temperatures. We created two sets of primers.
Build
We ordered our sequences with Integrated DNA Technologies (IDT) in order to begin testing. We resuspended our primer upon arrival, and performed a 1:10 dilution on each primer so that we may use them for the PCR amplification protocol. We then amplified the linearized plasmid because the primers were placed in a manner that would cause them to create a kink in the middle of the M13KE vector. We followed the protocol listed below, except for once change in which we used the Klenow Polymerase Fragment:
Test
In order to verify the length and correct linearization of the vector, we conducted a 1% DNA gel in order to test our size. We ran our entire volume on the gel, which was 20 microliters. According to our gel below our sequences matched up with the same length that we expected; therefore, we concluded that the linearization was accurate. The expected size was around 7000 bp.
Learn
Our sequences matched up, so we learned that these primers ere the correct ones that we designed properly in order to effectively linearize the vector, so that we may insert our epitope onto the phage vector.