Why Cats?
Cats are known to be the definitive host of Toxoplasma Gondii as they host the sexual cycle of the parasite in their intestines, and then aid the parasite’s spread through its feces. The sexual cycle of the parasite involves the gametes fusing to form unsporulated oocysts. Those unsporulated oocysts eventually leave the cat through feces and sporulate once in the environment. Most cats are also asymptomatic carriers of the parasite, thus making it even more difficult to prevent the spread of T. Gondii. Majority of Toxoplasmosis that occurs in cats is never detected and Our team wants to target the root cause of the Toxoplasma Gondii spreading by tackling the parasite in cats as a preventative method.
Our edible vaccine is designed to trigger an immune response in cats so the oocysts are targeted inside in the intestine while they are still unsporulated. Once M-13 phages with T. Gondii specific antigen are being produced in the cat’s intestines, they will be transferred into the lymph through the process of transcytosis. After that, an immune response will produce antibodies to target the oocysts. This way, the potential chance of oocysts sporulating and spreading in the environment is eliminated.
Why Oocysts?
Toxoplasma gondii is in the form of oocysts when it is released through the feces of the definitive host. We aimed to prevent the spread of the parasite before it is able to infect and harm other species by targeting the oocyst stage specifically. When the oocyst is released into the environment, it can be sporulated and eventually transition into later stages of the Toxoplasma gondii parasite’s life cycle, such as tachyzoites and bradyzoites. However, it is harder to regulate the spread of these later stages as they can be transported through soil, water, and intermediate hosts, which may include all mammals. By focusing on the stage the parasite is in while it is developing in the definitive host, we can significantly narrow down the group to administer vaccines to and prevent the parasite from circulating in the environment in the first place.
Why Phage Display?
Existing vaccinations for cats against T. gondii have been proven to lack effectiveness. For example, in 2020, Marinović et al. proposed vaccination via oocyst distribution in the environment; however, this model is inefficient and it would be nearly impossible to attain full cat vaccination with it. In 2019, Ramakrishnan et al. proposed a genetically attenuated live vaccine for cats against T. gondii; however, live attenuated vaccines are susceptible to unforeseeable mutation and possibly reversion to virulence. Thus, we propose a new approach to creating a vaccine for cats to prevent them from excreting the oocysts. Phages have been shown to have an ability to stimulate the adaptive and innate immune systems, and genes are easily inserted into a phage’s genome, so the protein of choice can be consistently expressed as fused onto natural surface proteins. Phage display also provides for a high level of specificity, since the exact antigen of choice can be exposed to the organism being vaccinated. Our goal is to develop a method to vaccinate cats efficiently and effectively against oocysts in particular, in a manner as controlled as possible.
Bacteria of Choice
We are planning to use bacteria that are confirmed to be edible and safe, like Lactococcus lactis, in the orally administered vaccine for cats to produce the phage. Lactococcus is involved in the fermentation of dairy products, including cheese and yogurt. Although they are not filamentous phages, which are most commonly used for phage display, Caudovirales bacteriophages can infect L. Lactis and may be able to replace M13 in our vaccine system when Lactococcus replaces E. coli. In fact, they would be able to display larger proteins and provide for peptide libraries that are more diverse, according to Jaroszewicz et al. in “Phage display and other peptide display technologies.” However, for our initial wet-lab experiment, we are choosing to use the M13 phage, which is a filamentous phage well-characterized for phage display, and the bacteria it infects, E. coli, specifically the F+ ER2738 strain.
Choosing Epitopes
For our approach to target unsporulated oocysts, we did literature research to find antigens on unsporulated oocysts. We specifically wanted antigens that were on unsporulated oocysts since the aim of our edible vaccine was to introduce a preventive approach towards limiting the spread of Toxoplasmosis. When the epitope from the antigen is inserted onto the phage, the goal is for the phage to transfer into the lymph through transcytosis and trigger an immune response so antibodies are developed against the oocysts. This way, in the future if a cat were to get infected with Toxoplasmosis, the cat would already have antibodies to target the unsporulated oocysts, thus preventing the oocysts from leaving the cat and potentially sporulating in the environment.
The binding epitopes we used were from the tyrosine-rich oocyst wall protein (TrOWP2) antigen. The peptides that comprise linear B-cell epitopes can be used in place of antigens when producing antibody responses via immunization. As such, we can attach an epitope peptide sequence to our phage-based vaccine in order to effectively immunize the cat. To better understand and determine the locations of these epitopes, we used several web-based software in order to predict, as well as visualize the location of the antigen’s epitope region. We also found other antigen sequences through literature review and selected the two antigens with the highest levels of antigenicity.
Using the newfound sequence FKCAEGTTETIDGDCKRLKQFPP, Alpha Fold via the collabfold web server was used to produce 3D protein models that we could then use for additional analysis of the epitope’s properties based on the structure. With these models, we predicted the epitope sequence to be TTTAAATGTGCCGAAGGAACAACGGAGACTATTGACGGTGACTGCAAGCGCTTGAAGCAGTTTCCGCCA. The other two epitope sequences were TNNEDEQ and QGNDEHSSQ. We found the DNA sequences of these through literature review.
Design of Primers
We designed our primers using Benchling. We chose sequences on either side of the site of insertion that were an agreeable length, between about 20 and 30 base pairs, and had matching annealing temperatures. We created two sets of primers. The first set of primers contained our forward primer, the part BBa_K4734001, and our reverse primer, the part BBa_K4734002. The forward primer sequence for this set is tcggccgaaactgttgaaagttg, and the reverse primer sequence for this set is cgagtgagaatagaaaggtaccactaaagg. The second set of primers contained a forward primer with the sequence tcggccgaaactgttgaaag and a reverse primer with the sequence cgagtgagaatagaaaggtaccac.
