Design

The collagen-like region from Scl2.28 (AY069936) we chose as our protein of interest had repeated sequences, which lead to a high complexity score. As such, we were unable to place the order for synthesis from IDT. Hence, we considered using Gibson Assembly for assembling the plasmid. For this we fragmented the original sequence into four different parts. The E. coli proline (JW0233) and lysine (JW2806) auxotroph strains are derived from K12, so we codon-optimized the fragments. By doing so, we were able to synthesize the gene of interest.

Original Scl2

      CAAGACGGTCGAAACGGTGAAAGAGGGGAACAAGGACCAACAGGTCCAACCGGACCTGCTGGTCCACGAGGTCTACAAGGTCTACAAGGTCTACAAGGTGAAAGAGGGGAACAAGGACCAACAGGTCCCGCTGGTCCACGAGGTCTACAAGGTGAAAGAGGGGAACAAGGACCAACAGGTCTCGCT
    

   GGTAAAGCCGGTGAAGCTGGAGCCAAAGGCGAAACCGGCCCCGCTGGTCCACAGGGTCCACGTGGTGAACAAGGCCCGCAAGGTCTTCCAGGTAAAGATGGTGAAGCTGGTGCTCAAGGCCCAGCAGGTCCAATGGGTCCTGCTGGTGAGCGAGGTGAAAAAGGAGAACCTGGTACCCAAGGCGCTAAAGGT
    

    GATCGCGGTGAAACCGGTCCAGTAGGTCCACGTGGTGAGCGAGGCGAAGCCGGTCCCGCTGGAAAAGATGGTGAACGTGGTCCAGTAGGTCCAGCTGGTAAGGACGGCCAAAACGGCCAAGATGGTCTTCCAGGTAAAGACGGTAAGGACGGCCAAAACGGTAAAGATGGTCTTCCAGGTAAAGACGGTAAGGAC
    

    GGCCAAAACGGTAAAGATGGTCTTCCAGGTAAAGACGGTAAGGACGGTCAAGATGGTAAAGACGGCCTCCCAGGTAAAGACGGTAAAGATGGCCTCCCAGGTAAGGACGGTAAGGACGGTCAACCAGGTAAACCGGCT
    

Optimized for E. coli K12

    CAAGACGGTCGTAATGGCGAACGCGGCGAACAGGGGCCTACAGGCCCCACTGGCCCAGCCGGGCCACGCGGTCTTCAGGGACTGCAAGGGTTGCAAGGTGAGCGTGGAGAACAGGGTCCTACCGGGCCAGCAGGTCCCCGTGGACTTCAGGGTGAACGTGGGGAGCAAGGTCCCACCGGCTTAGCT (Total Complexity Score: 8.1)
    

    GGTAAAGCGGGGGAAGCTGGTGCAAAAGGAGAGACGGGTCCAGCCGGTCCCCAGGGCCCACGTGGTGAGCAAGGCCCCCAAGGCTTACCTGGCAAGGATGGCGAGGCTGGCGCGCAAGGCCCGGCAGGCCCAATGGGACCCGCAGGAGAACGCGGAGAAAAGGGTGAACCAGGCACTCAAGGTGCCAAAGGT (Total Complexity Score: 7.6)
    

    GATCGCGGAGAAACGGGACCGGTCGGTCCTCGTGGAGAACGTGGGGAAGCAGGCCCCGCAGGGAAGGATGGTGAGCGTGGCCCCGTTGGACCAGCCGGAAAAGATGGGCAGAACGGCCAGGACGGCTTACCGGGGAAAGACGGAAAAGATGGCCAAAATGGTAAGGATGGTTTACCAGGGAAAGATGGTAAGGAC (Total Complexity Score: 7.4)
    

    GGCCAGAATGGGAAGGACGGGTTGCCAGGAAAAGACGGCAAAGACGGACAAGATGGTAAAGATGGACTGCCGGGCAAGGATGGAAAGGATGGCTTACCGGGAAAAGACGGTAAGGATGGACAGCCGGGCAAGCCAGCT (Total Complexity Score: 7.6)
    

Build

We used PCR to amplify the fragments and generate the overhangs needed for Gibson Assembly with the denaturation at 95°C, annealing at 62°C, and extension at 72°C.

Test

To verify whether the fragments were successfully generated, we performed gel electrophoresis with a 0.75% agarose gel. From the gel, we were able to identify the bands for the 3 fragments, but not for the fourth fragment. The 500 bp ladder was inappropriate for this gel electrophoresis run.

Learn

To identify the error, we went back to the NEB Assembly tool and realized that the annealing temperature of the primers for the fourth fragment (particularly the reverse primer) was much higher than the three other fragments as shown in the picture below.

We redid PCR for the fourth fragment at an increased annealing an extension temperature of 70°C and 75°C, keeping other parameters the same. We reran the gel with an appropriate ladder and the fragment was visible (Lane 5). Lane 6 shows the PCR product from the previous run.

Design

In terms of experimental design, we choose to perform cloning via restriction enzyme double digestion. Our gene of interest (Scl2.28) was synthesized by GenScript and inserted into pUC57-Kan with BamHI and HindIII cut site flanking the insert. BamHI and HindIII cut sites were present in the MCS of the vector (pQE80L-Kan)

Build

We performed double digestion of our vector (pQE80L-Kan) using BamHI-HF (NEB, R3136) and HindIII-HF (NEB, R3104). As per NEB’s restriction enzyme single/double digestion tool, we performed the double digestion at 37°C for 15 minutes.

Test

To verify successful double digestion before proceeding with ligation, we performed gel electrophoresis with a 1% agarose gel. From the gel, we were able to clearly identify the two fragments for the pUC57-Kan indicating successful digestion. The insert should be 717 bp long, and we saw corresponding band. For the vector (pQE80L-Kan) it was difficult to identify successful digestion because the region between the two restriction enzymes was only 42 bp long.

Learn

Since we were unsure of double digestion, we decided to redo the double digestion for the vector. The plasmid with the insert travelled further than expected most likely because of being supercoiled. Hence, we decided to perform a single digest to identify the actual size of the plasmid. The single digested pUC57-Kan (3260 bp) showed up in the expected range in the gel. For the vector, we still weren’t able to see any significant difference between the undigested and digested plasmid. The fragment in between the restriction sites were also not visible while running the gel with a 100 bp ladder and higher percentage of agarose. We hypothesized that the timing for the digestion was not enough and decided to perform double digestion for longer.

Design/Build

Learning from the previous iteration, we performed double digestion of the vector for 1 hour and 2 hours. Single digestion was also performed to characterize the size of the vector.

Test

The gel electrophoresis of double digested plasmid for both the timings were similar to previous iteration and was not conclusive. The single digested plasmid (4541 bp) was in similar range to the undigested plasmid.

Learn

We decided to consult Dr. N. Ayyadurai (Principal Scientist at CSIR-Central Leather Research Institute, Chennai, India), whose influential paper on incorporation of hydroxyproline into bacterial collagen like protein, we were referencing. During the consultation, he mentioned that the moustache-like overhangs we were observing in the double digested plasmid was indicative of successful digestion. With this knowledge, we decided to proceed with ligation and transformation.