We have created a novel component (bricks) for future utilization.
The standard part entails the insertion of a switch protein sequence into the pET-22b (+) plasmid. It is designed to express binding proteins triggered by heavy metal cadmium and reporter proteins. This module serves the purpose of detecting the presence and concentration of cadmium in samples. To construct the standard part, the switch protein was synthesized, and the restriction enzyme information was examined, as depicted below (Figure 1).

GGGAGGGAACTGTTGTGGTATTATTTTTGGTTGTGCAGTAGGGCGGGATTAAAGAGGAGAAACCAAAAATGATACCACAACAGCATATGAACATCCAGATTGGCGAACTGGCAAAACGTACCGCATGTCCGGTTGTTACCATTCGTTTTTATGAACAGGAAGGTCTGCTGCCGCCGCCGGGTCGTAGCAGAGGTAATTTTCGTCTGTATGGTGAAGAACATGTTGAACGCCTGCAGTTTATTCGTCATTGTCGTAGTCTGGATATGCCGCTGAGCGATGTTCGCACCCTGCTGAGCTATCGTAAACGCCCGGATCAGGATTGTGGCGAAGTGAATATGCTGCTGGATGAACATATTCGCCAGGTTGAAAGTCGCATTGGTGCACTGCTGGAACTGAAACATCATCTGGTGGAACTGCGCGAAGCATGCAGCGGTGCCCGCCCTGCTCAGAGCTGCGGTATTCTGCAGGGCCTGAGTGATTGTGTTTGTGATACCCGTGGTACCACCGCACATCCGAGTGATGGTGGTGGCGGCAGTGGCGGCGGCGGTAGCATGGTTAGCAAAGGTGAAGAACTGTTTACCGGCGTTGTTCCGATTCTGGTGGAATTAGATGGCGATGTTAATGGTCATAAATTTTCTGTGAGTGGCGAAGGCGAAGGCGATGCCACCTATGGTAAACTGACCCTGAAATTCATTTGTACCACCGGCAAACTGCCGGTTCCGTGGCCGACCCTGGTGACCACCCTGACCTATGGCGTTCAGTGTTTTAGCCGTTATCCGGATCACATGAAACAGCATGATTTCTTTAAAAGTGCAATGCCGGAAGGTTATGTGCAGGAACGTACCATTTTCTTTAAAGATGATGGCAATTACAAGACCCGTGCCGAAGTGAAATTTGAAGGCGATACCCTGGTGAATCGTATTGAACTGAAAGGTATTGATTTCAAAGAGGATGGTAATATTCTGGGTCATAAACTGGAATATAACTATAATAGCCACAACGTTTACATCATGGCAGATAAACAGAAAAATGGTATTAAGGTTAACTTCAAGATCCGCCATAATATTGAAGATGGCAGTGTTCAGCTGGCCGATCATTATCAGCAGAATACCCCGATTGGCGATGGCCCGGTGCTGCTGCCGGATAATCATTATCTGAGTACCCAGAGCGCACTGAGCAAAGATCCGAATGAAAAACGTGATCACATGGTGCTGCTGGAATTTGTGACCGCAGCAGGCATTACCCTGGGTATGGATGAACTGTATAAACTCGAGAGAAAGGCAGCAGGTCGTATAGGGACTTTAGAACAGAGGAGATAAAGATGCTATACGACAACCTGGCGGCAGCGCAAAAGATGTCTTATTCAAAGCATGGCATCGTACAAGAAATGAAGACGAAATACCATATGGAAGGCAGTGTCAATGGCCATGAATTTACGATCGAAGGTGTAGGAACTGGGTACCCTTACGAAGGGAAACAGATGTCCGAATTAGTGATCATCAAGCCTGCGGGAAAACCCCTTCCATTCTCCTTTGACATACTGTCATCAGTCTTTCAATATGGAAACCGTTGCTTCACAAAGTACCCGGCAGACATGCCTGACTATTTCAAGCAAGCATTCCCAGATGGAATGTCATATGAAAGGTCATTTCTATTTGAGGATGGAGCAGTTGCTACAGCCAGCTGGAACATTCGTCTCGAAGGAAATTGCTTCATCCACAAATCCATCTTTCATGGCGTAAACTTTCCCGCTGATGGACCCGTAATGAAAAAGAAGACAATTGACTGGGATAAGTCCTTCGAAAAAATGACTGTGTCTAAAGAGGTGCTAAGAGGTGACGTGACTATGTTTCTTATGCTCGAAGGAGGTGGTTCTCACAGATGCCAATTTCACTCCACTTACAAAACAGAGAAGCCGGTCACACTGCCCCCGAATCATGTCGTAGAACATCAAATTGTGAGGACCGACCTTGGCCAAAGTGCAAAAGGCTTTACAGTCAAGCTGGAAGCACATGCCGCGGCTCATGTTAACCCTTTGAAGGTTAAATAATAA

Figure 1. Map of the linear neck-loop switch analyzed using SnapGene Viewer, displaying the restriction enzyme information (EcoRI and HindIII sites absent).

Upon verifying the restriction enzyme information of the switch protein using SnapGene software, it was integrated into the pET-22b (+) plasmid, creating the standard part via PCR. The outcome is presented as follows (Figure 2).

Figure 2. Enzymatic cleavage map using PCR and EcoRI and HindIII digestion identification. Marker, 1 - Double-enzyme cleaved target gene; 2 - Plasmid.

The switch protein plasmid is designed for the expression of binding proteins controlled by heavy metal cadmium and fluorescent proteins. It encompasses the cadmium aptamer sequence, RBS, partial aptamer complementary sequence, which form a switch, followed by genes encoding the cadmium-binding protein and the tagged fluorescent protein. In the presence of cadmium, it binds to its aptamer sequence, activating the switch to trigger the expression of binding and fluorescent proteins, which can be easily measured. The mechanism is illustrated in Figure 3.

Figure 3. Mechanism of the fluorescent protein switch gene.

Simultaneously, the switch fluorescent protein was cloned into the pET-22b (+) expression vector to construct the recombinant plasmid pET-22b-fluorescent protein switch. After transfection into the BL21 strain, no green fluorescent protein (GFP) (green color) was observed by the naked eye, indicating the efficacy of the switch, as shown in Figure 4.

Figure 4. Efficacy test of the switch protein. Bacterial clones transfected with the switch protein alone appear white, while bacterial clones transfected with both the switch protein and aptamer exhibit yellow-green color (aptamer sequence activates the expression of GFP).

Figure 5. GFP expression in the BL21 strain.
To enhance the yield of fluorescent and binding proteins, various cultivation conditions were optimized, including fermentation time and heavy metal ion concentration. BL21 strains containing the switch plasmid were cultivated under different conditions. Because the reporter protein GFP is coloured at different intensities, the optimal conditions were easily discerned by monitoring color changes. Optimization experiments revealed that a 1-hour reaction time was the most favorable condition for high yield of Escherichia coli reporter protein.

Figure 6. Optimization of BL21 strain cultivation conditions with the switch fluorescent protein plasmid and various cadmium concentrations.

Our heavy metal detection approach relies on nucleic acid aptamers, leveraging color changes on paper-based sensors. Currently, other methods can also detect heavy metals in the laboratory, but they involve complex procedures, and also have high requirements for personnel, equipment, and environment, high costs, and extended timeframes.

Introduction

To facilitate quick access to diagnostic test results, we have created a compact device (Figure 6). The device features a side window for accommodating two paper strips: one for reference and the other for sample testing, enabling qualitative and quantitative analysis. The device also has a smartphone holder, retractable for accommodating smartphones of various sizes and specifications, is situated on the device. Smartphones are used for image acquisition. The device is equipped with appropriate light sources internally to provide ample brightness and offers different light sources to stimulate various colors of reporter proteins.

Paper-Based Sensors

Reagents and materials relevant to the cell-free system are lyophilized onto the paper strips. During testing, the sample is added to the blank area of the paper strip. To ensure more accurate detection, blank control experiments are conducted simultaneously when working with experimental paper strips.

Figure 7. Paper-based sensors for the detection and adsorption of heavy metals in water environments. A, Schematic diagram; B, Water solution detection results; C, Fluorescence intensity analysis.

References

[1] GENG H, XU Y, ZHENG L, et al. An overview of removing heavy metals from sewage sludge: Achievements and perspectives [J]. Environmental Pollution, 2020, 266: 115375.
[2] YUAN J, LU Y, WANG C, et al. Ecology of industrial pollution in China [J]. Ecosystem Health and Sustainability, 2020, 6(1): 1779010.
[3] Alexander A. Green,1 Pamela A. Silver,1,2 James J. Collins,1,3 and Peng Yin. Toehold Switches: De-Novo-Designed Regulators of Gene Expression. Cell 159, 925–939, November 6, 2014. http://dx.doi.org/10.1016/j.cell.2014.10.002
[4] XU J, JIANG R, FENG Y, et al. Functional nucleic acid-based fluorescent probes for metal ion detection [J]. Coordination Chemistry Reviews, 2022, 459: 214453.