1) Materials
|
Reagents |
Apparatus |
|
TRIzol |
Micro-centrifuge tube (1.5 mL) |
|
Chloroform |
Pipette (range: 1 μL-10 μL) |
|
Isopropanol |
Pipette (range: 0.1 mL-1 mL) |
|
Ethanol (75%) |
Centrifuge |
|
5× HiScript III RT SuperMix |
Spectrophotometer |
|
DNase/RNase-free water |
Thermostat |
2) Procedure
Ø Total RNA extraction
u Remove cell growth media.
u Add 1 mL of TRIzol reagent directly to the cell culture plate to lyse the cells.
u Pipet the lysate up and down several times to homogenize.
u Incubate for 5 min to permit complete dissociation of the nucleoproteins complex.
u Transfer the lysate to a tube.
u Add 0.2 mL of chloroform, then securely cap the tube.
u Upside down a few times, then incubate for 5 min at room temperature.
u Centrifuge the sample for 15 min at 12,000 × g at 4℃.
u Transfer the colorless upper aqueous phase to a new tube.
u Add 0.5 mL of isopropanol, then incubate for 10 min at room temperature.
u Centrifuge the sample for 10 min at 12,000 × g at 4℃.
u Remove the the supernatant.
u Add 1 mL of 75% Ethanol to the tube and pipet up and down several times.
u Centrifuge the sample for 10 min at 12,000 × g at 4℃.
u Remove the the supernatant and open the lid of tube.
u Dry for few minutes at room temperature.
u Dissolve RNA with 20 μL of DNase/RNase-free water.
u Detect RNA concentration by using a spectrophotometer.
Ø Reverse transcription
u Prepare reaction solution.
|
Reagents |
Volume/mass |
|
Total RNA |
1 μg |
|
5× HiScript III RT SuperMix |
4 μL |
|
DNase/RNase-free water |
to 20 μL |
u Set up reaction program.
|
37℃ |
15 min |
|
|
Step 2 |
85℃ |
5 s |
|
Step 3 |
10℃ |
∞ |
u Start the program.
1) Materials
|
Reagents |
Apparatus |
|
Template cDNA |
PCR tube (0.2 mL) |
|
Forward primer (20 μM) * |
Pipette (range: 1 μL-10 μL) |
|
Reverse primer (20 μM) * |
Pipette (range: 1 μL-100 μL) |
|
2× Rapid Taq Master Mix |
Centrifuge |
|
DNase/RNase-free water |
Thermostat |
2) Procedure
Ø Prepare reaction solution.
|
Reagents |
Volume |
|
Template cDNA |
5 μL |
|
Forward primer (20 μM) * |
1 μL |
|
Reverse primer (20 μM) * |
1 μL |
|
2× Rapid Taq Master Mix |
25 μL |
|
DNase/RNase-free water |
to 50 μL |
Ø Set up reaction program.
|
Step 1 |
98℃ |
10 s |
|
Step 2 |
55℃ |
15 s |
|
Step 3 |
72℃ |
60 s |
|
Step 4 |
Goto step 1, 30 more times |
|
|
Step 5 |
4℃ |
∞ |
Ø Start the program.
* Sequence of primers：
|
Gene |
Forward primer |
Reverse primer |
|
OGN |
GAATTCATGGAGACTGTGCACTCTA |
CTCGAGTTAGAAGTATGACCCTA |
1) Materials
|
Reagents |
Apparatus |
|
ShRNA-1/-2/-N sequences |
PCR tube (0.2 mL) |
|
5× Annealing buffer for DNA oligos |
Pipette (range: 1 μL-10 μL) |
|
|
Centrifuge |
|
|
Thermostat |
2) Procedure
Ø Prepare reaction solution.
|
Reagents |
Volume |
|
ShRNA-1/-2/-N forward sequences (20 μM) * |
10 μL |
|
ShRNA-1/-2/-N reverse sequences (20 μM) * |
10 μL |
|
5× Annealing buffer for DNA oligos |
5 μL |
Ø Set up reaction program.
|
Step 1 |
95℃ |
2 min |
|
Step 2 |
decrement 0.1℃ every 8 s |
|
|
Step 3 |
Goto step 2, 700 more times |
|
|
Step 4 |
4℃ |
∞ |
Ø Start the program.
* Sequence of ShRNA：
|
ShRNA |
Forward |
Reverse |
|
ShRNA-1 |
5’-GATCCGATGCCCACATGC CTGTTGTCTGTGAAGCCACAGATGGGACA ACAGGCATGTGGGCATCTTTTTTG-3’ |
5’-GATCCGATGCCCACATGCCT GTTGTCTGTGAAGCCACAGATGGGACAAC AGGCATGTGGGCATCTTTTTTG-3’ |
|
ShRNA-2 |
5’-GATCCGTCAGCTTATCTTTATG CACCTGTGAAGCCACAGATGGGGTGCATAAAG ATAAGCTGACTTTTTTG-3’ |
5’-AATTCAAAAAAGTCAGCTT ATCTTTATGCACCCCATCTGTGGCTTCACAG GTGCATAAAGATAAGCTGACG -3’ |
|
ShRNA-N |
5’-GATCCGCCAGA CCTGCAACCGATATCTGTGAAGCCACAGA TGGGATATCGGTTGCAGGTCTGGCTTTTTTG-3’ |
5’-AATTCAAAAAAGCCA GACCTGCAACCGATATCCCATCTGTGGCT TCACAGATATCGGTTGCAGGTCTGGCG -3’ |
1) Materials
|
Reagents |
Apparatus |
|
Vector or OGN fragment |
Micro-centrifuge tube (1.5 mL) |
|
CutSmart |
Pipette (range: 1 μL-10 μL) |
|
Pipette (range: 1 μL-100 μL) |
|
|
XhoI enzyme |
Centrifuge |
|
ddH2O |
Thermostat |
2) Procedure
Ø Prepare reaction solution in tubes.
|
Reagents |
Volume/mass |
|
Vector or OGN fragment |
1 μg |
|
CutSmart |
5 μL |
|
EcoRI enzyme |
1 μL |
|
XhoI enzyme |
1 μL |
|
ddH2O |
to 50 μL |
Ø Centrifuge the liquid to the bottom of the tubes.
Ø Place the tubes in the thermostat at 37℃ for 15 min and 65℃ for 20 min.
1) Materials
|
Reagents |
Apparatus |
|
Vector (digested pCMV-3Tag-1A) |
Micro-centrifuge tube (1.5 mL) |
|
OGN fragment |
Pipette (range: 1 μL-10 μL) |
|
T4 DNA Ligase |
Pipette (range: 0.1 μL-2.5 μL) |
|
10× T4 DNA Ligase Buffer |
Centrifuge |
|
ddH2O |
Thermostat |
2) Procedure
Ø Prepare reaction solution in a tube
|
Reagents |
Volume/mass |
|
Vector (digested pCMV-3Tag-1A) |
0.03 pmol |
|
OGN fragment |
0.3 pmol |
|
T4 DNA Ligase |
1 μL |
|
10× T4 DNA Ligase Buffer |
1 μL |
|
ddH2O |
to 10 μL |
Ø Centrifuge the liquid to the bottom of the tube.
Ø Place the tube in the thermostat at 16℃ overnight.
1) Materials
|
Reagents |
Apparatus |
|
pCMV-3Tag-1A-OGN |
Pipette (range: 1 μL-10 μL) |
|
DH5α chemically competent cell |
Pipette (range: 1 μL-100 μL) |
|
Petri dish |
|
|
LB solid medium (Kan+) |
Thermostat |
|
|
Shaker |
|
|
Incubator |
2) Procedure
Ø Transformation
u Thaw 30 μL of competent cells on ice for 1-2 min.
u Mix the cells with 1 μL of plasmid (pCMV-3Tag-1A-OGN) in a tube.
u Place the tube on ice for 30 min.
u Heat shock: place the tube in the thermostat at 42℃ for 45 s.
u Place the tube in ice bath immediately and cool it for 2-3 min.
Ø Resuscitation
u Add 1 mL of LB liquid medium (Kan-) to the tube.
u Mix the solution uniformly, and incubate it in the shaker at 37℃, 220 rpm for 45-60 min.
Ø Incubation
u Aspirate 100 μL of transformed competent cells with one pipette.
u Coat them uniformly on the LB solid media (Kan+).
u Place the petri dish at room temperature until the solution is absorbed.
u Turn the dish upside down and incubate the cells at 37℃ for 12-16 h.
1) Materials
|
Reagents |
Apparatus |
|
TIANpure Midi Plasmid Kit |
Micro-centrifuge tube (1.5 and 2 mL) |
|
Bacterial solution |
Pipette (range: 0.1 mL-1 mL) |
|
PBS |
Vortex machine |
|
|
Centrifuge |
2) Procedure
Ø Follow the manufacturer’s instruction.
1) Materials
|
Reagents |
Apparatus |
|
Agarose |
|
|
TAE buffer |
|
|
Electronic balance |
|
|
DNA loading buffer (10×) |
Spatula |
|
DNA Marker |
Microwave oven |
|
DNA sample |
Mold for creating gel |
|
|
Electrophoresis chamber |
|
|
UV transilluminator |
|
|
Scalpel |
2) Procedure
Ø Gel preparation
u Place the weighing paper on the electronic balance, weigh 1g of agarose, and pour it into the conical flask.
u Pour 100 mL of TAE buffer into the conical flask and shake it.
u Cover the conical flask with the aluminum foil and place it into the microwave oven for 3 min, until the granules of agarose are well dissolved and invisible.
u Use the pipette to transfer 10 μL of YeaRed nucleic acid gel stain into the conical flask and shake it.
u Pour the gel into the mould and insert a “comb” into the gel.
u Wait for 10 min until the gel is solidified.
Ø Electrophoresis
u Pour about 400 mL of TAE buffer into the electrophoresis chamber.
u Carefully take out the gel and place it in the electrophoresis chamber.
u Mix the loading buffer and DNA sample by using the pipette.
u Use the pipette to add 5 μL of marker in the first hole of the gel, then add 10 μL of each sample into the following holes.
u Turn on the power of the electrophoresis chamber and wait for about 30 min (the specific time should depend on the loading buffer we used).
Ø Authentication and recycle
u Take out the gel and place it on the UV tray. The UV tray will then be placed into the UV transilluminator.
u Scan the gel.
u Comparing with the marker reference, determine the target bands which will be extracted during the recycling process.
u Use the scalpel to cut the target bands of the gel.
1) Materials
|
Reagents |
Apparatus |
|
TIANgel Midi Purification Kit |
Micro-centrifuge tube (1.5 mL) |
|
Agarose gel |
Pipette (range: 0.1 mL-1 mL) |
|
|
Centrifuge |
2) Procedure
Ø Follow the manufacturer’s instruction.
1) Materials
|
Reagents |
Apparatus |
|
pCMV-3Tag-1A-OGN |
Tube (1.5 mL) |
|
ATDC5 cells |
|
|
Lipofectamine 2000 |
Pipette (range: 1 μL-100 μL) |
|
MEM medium |
Pipette (range: 0.1 mL-1 mL) |
|
OPTI-MEM medium |
Incubator |
2) Procedure
Ø Add 2 μg of pCMV-3Tag-1A-OGN, 2 μL of Lipofectamine 2000 into a tube with 200 μL of OPTI-MEM medium.
Ø Mix the solution gently and incubate at room temperature for 20 min.
Ø Replace the cell growth medium with 800 μL of MEM medium.
Ø Add the solution to the cell culture plate and shake gently.
Ø Incubate the cells at 37℃ for 4 h.
Ø Replace the MEM medium with the cell growth medium.
Ø Incubate the cells at 37℃ for another 24 h.
1) Materials
|
Reagents |
Apparatus |
|
4% paraformaldehyde |
Centrifuge tube (range: 15 mL) |
|
Alcian blue 8GX |
Electronic balance |
|
Acetic acid |
Pipette (range: 0.1 mL-1 mL) |
|
PBS |
Shaker |
|
dH2O |
Microscope |
2) Procedure
Ø Prepare 1% Alcian blue dyeing solution.
|
Reagents |
Volume/mass |
|
Alcian blue 8GX |
1 g |
|
Acetic acid |
3 mL |
|
dH2O |
97 mL |
Ø Remove the cell growth medium and wash the cells with PBS.
Ø Fix the cells with 4% paraformaldehyde at room temperature for 15 min.
Ø Wash the cells with dH2O for three times (5 min each time).
Ø Incubate the cells with Alcian blue dyeing solution at 4℃ overnight.
Ø Recycle the dye solution.
Ø Wash the cells with dH2O for three times (5 min each time).
Ø The cells were maintained in dH2O and captured by using a microscope.
1) Materials
|
Reagents |
Apparatus |
|
Protein sample |
Pipette (range: 1 μL-10 μL) |
|
Running buffer |
Pipette (range: 0.1 μL-2.5 μL) |
|
Loading buffer |
Electrophoresis chamber |
|
Marker |
|
|
PAGE (12%) |
|
2) Procedure
Ø Insert the prepared gel (12% BT) into the electrophoresis chamber.
Ø Add running buffer into the chamber until the gel is submerged.
Ø Mix the protein sample and loading buffer.
Ø Add 1.5 μL of marker to the first hole of the gel and add 10 μL of mixed sample solution to the following holes.
Ø Set up the electrophoresis program.
|
Step 1 |
80 V |
30 min |
|
Step 2 |
120 V |
60 min |
Ø Start the program.
1) Materials
|
Reagents |
Apparatus |
|
Rabbit anti-OGN antibody |
Trans-blot transfer |
|
Mouse anti-β-actin antibody |
NC membrane |
|
HRP-conjugated Goat Anti-Rabbit IgG |
Shaker |
|
HRP-conjugated Goat Anti-Mouse IgG |
Box (1 dm×1 dm×0.5 dm) |
|
TBST solution |
|
|
Clarity Western ECL Substrate |
|
|
5% defatted milk solution |
|
|
Gel with protein after SDS-PAGE |
|
2) Procedure
Ø Transfer
u Place the gel and NC membrane in the trans-blot transfer.
u Submerge trans-blot transfer in the ice bath.
u Set the transfer program at 320 mA, 90 min.
u Start the program.
Ø Blocking
u Turn the membrane to a box, add TBST solution into it, and rinse the membrane for 1-2 min.
u Discard the TBST solution.
u Add 5% defatted milk into the box until the membrane is submerged.
u Place the box on the shaker at room temperature for 2 h.
Ø Primary antibody incubation
u Discard the milk in the box.
u Add rabbit anti-OGN antibody or mouse anti-β-actin antibody solution to the box.
u Place the box on the shaker at 4℃ overnight.
u Recycle the primary antibody solution.
u Rinse the membrane with TBST solution three times, 15 min for each time.
Ø Secondary antibody incubation
u Discard the TBST solution in the box.
u Add HRP-conjugated Goat Anti-Rabbit IgG or HRP-conjugated Goat Anti-Mouse IgG solution to the box.
u Place the box on the shaker at room temperature for 2 h.
u Recycle the secondary antibody solution.
u Rinse the membrane with TBST solution three times, 15 min for each time.
Ø Detection of proteins
u Add Clarity Western ECL Substrate solution into the box until the membrane is evenly soaked.
u Use the software GelCap to scan the membrane.
1) Materials
|
Reagents |
Apparatus |
|
ChamQ SYBR qPCR Master Mix (2×) |
PCR tubes (0.1 mL) |
|
Template cDNA |
Pipette (range: 1 μL-10 μL) |
|
Forward primer (20 μM) * |
Pipette (range: 0.1 μL-2.5 μL) |
|
Reverse primer (20 μM) * |
qPCR thermal cycler |
|
ddH2O |
|
2) Procedure
Ø Prepare reaction solution.
|
Reagents |
Volume |
|
ChamQ SYBR qPCR Master Mix (2×) |
10 μL |
|
Template cDNA |
0.1 μL |
|
Forward primer (20 μM) * |
0.25 μL |
|
Reverse primer (20 μM) * |
0.25 μL |
|
ddH2O |
9.5 μL |
Ø Set up the reaction program.
|
95℃ |
10 s |
|
|
Step 2 |
95℃ |
5 s |
|
Step 3 |
56℃ |
20 s |
|
Step 4 |
10 s |
|
|
Step 5 |
Goto step 2, 45 more times |
|
|
Step 6 |
72℃ |
10 min |
|
Step 7 |
Melt Curve 50 to 95℃, increment 0.5℃ for 5 s |
|
|
Step 8 |
10℃ |
5 min |
|
End |
||
Ø Start the program.
* Sequence of primers：
|
Gene |
Forward primer |
Reverse primer |
|
OGN |
ACCATAACGACCTGGAATCTGT |
AACGAGTGTCATTAGCCTTGC |
|
Col2α1 |
GGGAATGTCCTCTGCGATGAC |
GAAGGGGATCTCGGGGTTG |
|
Aggrecan |
CCTGCTACTTCATCGACCCC |
AGATGCTGTTGACTCGAACCT |
|
Sox9 |
GAGCCGGATCTGAAGAGGGA |
GCTTGACGTGTGGCTTGTTC |
|
MMP3 |
ACATGGAGACTTTGTCCCTTTTG |
TTGGCTGAGTGGTAGAGTCCC |
|
MMP13 |
CTTCTTCTTGTTGAGCTGGACTC |
CTGTGGAGGTCACTGTAGACT |
|
β-Actin |
GGCTGTATTCCCCTCCATCG |
CCAGTTGGTAACAATGCCATGT |