Premises

• After every deletion or insertion in plasmids, the product was screened in agarose 1% gel and the region of interest was sequenced by using the Eurofins Genomics service (Sanger sequencing); the sequencing primers were designed using Benchling.com (San Francisco, California, USA) and synthesized by Merk KGaA, Darmstadt, Germany.
• Every restriction enzyme we used during the experiments was part of FastDigest enzymes by ThermoFisher Scientific (Waltham, Massachusetts, USA). They were used following the manufacturer’s instructions.
• The bacteria cells we used to perform the experiments were ATCC strains and made competent for the transformation using the specified protocols below.
• All the samples that needed to be extracted after a gel electrophoresis were purified using the QIAquick PCR & Gel Cleanup kit (Qiagen, Hilden, Germany).
• All the plasmids DNA extraction and purification from bacteria colonies were performed by using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany).
• The concentration of DNA samples and ratios were measured with NanoDrop (Thermo Scientific).

The project design was divided in two parts: Actuator and Delivery. The Delivery target was to synthesize an engineered M13cp bacteriophage with specific tropism for each KAPE bacteria. The phage was synthesized in E. coli cells transformed with the engineered phagemid pTZ19R and an engineered helper plasmid obtained by integrating the genome of M13 into the standard backbone pSB3K3.

The phagemid - pTZ19R (BBa_K4727003)

Starting from the commercially available construct of pTZ19R (ThermoFisher Scientific, Waltham, Massachusetts, USA), in order to obtain a standard compatible phagemid, we needed to make three crucial modifications to the sequence. Due to the nature of the necessary alterations, they were all performed with PCR mutagenesis.

1. A cell culture, bearing pTZ19R, was inoculated in selective liquid LB broth [100 ug/mL Ampicillin] and grown overnight in agitation at 220rpm, 37°C. The subsequent day, plasmid DNA extraction was performed by using the NEB kit, in order to extract the phagemid construct. A PCR mutagenesis was performed to delete the original multiple cloning site (MCS) carried by pTZ19R. The mutagenesis was carried out using the NEB PCR mutagenesis kit, with primers designed using Benchling.

   Fw deletion primer: gcatgcaagctttccctatag
   Rv deletion primer: actggccgtcgttttaca
   

   After that, the product was transformed into E. coli TOP10 and the following day the grown colonies were picked and inoculated in LB with ampicillin (100ug/ml). After plasmid extraction the colonies were checked for correct deletion.

2. Starting from the sequence just produced we carried out a similar process to insert the standard prefix and suffix (BioBrik RFC [10] standard) in a consecutive order. We performed the insertion using the same PCR mutagenesis kit and primer with overlapping ends (highlighted in capital letters) designed using Benchling.

   FW_prefix_insertion: CGGCCGCTTCTAGAGgcatgcaagctttccctatag
   RV_prefix_insertion: CGAATTCGAAGAAACactggccgtcgttttaca
   FW_suffix_insertion: CTGCAGGAAGAAACgcatgcaagctttccctatag
   RV_suffix_insertion: CGGCCGCTACTAGTActctagaagcggccgcgaat
   

3. Once the phagemid was obtained, we needed an easy way to assess our ability to transduce bacteria with the phages eventually produced. For this reason we decided to clone between the prefix and the suffix an expression cassette for a reporter gene, namely RFP, formed by BBa_R0040, BBa_B0034, BBa_E1010, BBa_B0010, BBa_B0012 (i.e., BBa_I13521). So, the phagemid and a plasmid containing the aforementioned cassette (pSB1A2) were digested with EcoRI and PstI restriction enzymes. After the incubation, samples were run in gel electrophoresis, and the corresponding band was excised and purified.

The purified vector (phagemid) and the insert (RFP expression cassette) were then ligated together, employing different ratios of insert over vector to ensure a higher output. The resulting ligation products were transformed into E. coli TOP10 chemically competent cells and then plated on LB agar supplemented with ampicillin (100 μg/mL) in order to select the successfully transformed cells. After overnight incubation at 37°C, colonies containing the desired DNA sequences were identified and picked for inoculation in selective LB nutrient broth [100 ug/mL Ampicillin]. The following day the plasmid was extracted.

The helper - pSB3KM13 (BBa_K4727002)

In order to construct a BioBrick RFC [10]-compliant helper plasmid, the genome of the M13 bacteriophage was integrated into a standard backbone, specifically pSB3K3. The starting point was the helper plasmid M13cp previously constructed by Chasteen et al. and kindly provided by Los Alamos National Laboratory (Los Alamos, New Mexico, USA), carrying the genes encoding the phage proteins and a p15a replication origin (ORI). Due to the compatibility and copy number characteristics conferred by this ORI, the pSB3K3 backbone, which carries the same origin, was chosen.

A plasmid DNA extraction was performed on 5mL of an E. coli overnight culture (LB selective liquid media with 25ug/mL Kanamycin, grown at 37°C, in agitation at 220 rpm) carrying a plasmid bearing pSB3K3. The unwanted insert, located between the prefix and the suffix of the plasmid, was then excised through enzymatic digestion using XbaI and SpeI restriction enzymes; this was then followed by the ligation of the cohesive ends in order to obtain the circularized plasmid. This plasmid served as a template for the insertion of a different MCS bearing the cut sites for Alw21I and MluI restriction enzymes. MCS was inserted via PCR mutagenesis using Q5 High-Fidelity DNA Polymerase (Promega, Madison, Wisconsin, USA) and the following PCR primers (the restriction sites of Alw21I and MluI respectively are indicated as underlined) designed with Benchiling to recognize the downstream region of pSB3K3 suffix.

After PCR mutagenesis and electrophoresis on agarose gel, the PCR product was purified. Next, 200 ng of the purified product were digested using the aforementioned restriction enzymes.

Concurrently, we extracted the M13 genome from M13cp helper plasmid [1]. To do so, 200 mL of an overnight culture (grown at 37°C, in agitation at 220 rpm) were subjected to plasmid extraction using the ZymoPURE II Plasmid Midiprep Kit (Zymo Research, Irvine, California, USA) following the manufacturer’s instructions. This construct was then subjected to enzymatic digestion with PstI and MluI restriction enzymes, with the aim to segregate the region containing the ORI and the selection marker from the segment harboring the M13 genome. The latter segment was isolated by running a gel electrophoresis, and the heavier band, measuring 6000 bp, was excised and purified.

Once obtained, the two DNA fragments, namely pSB3K3 with the new MCS that will serve as the new backbone and M13 genome that represents the insert, were ligated together to create a novel construct, hereinafter referred as pSB3KM13. The same ligation reaction was set up using three different molar ratios: to determine the ratios, the M13 genome was considered as the vector due to its longer length (6000 bp) in comparison to the actual backbone (2700 bp), which was regarded as the insert. After an overnight ligation, the entire reaction volume was transformed into chemically competent E. coli TOP10 cells, then plated on LB agar supplemented with kanamycin (25 μg/mL) and incubated overnight at 37°C. The next day, a total of 13 colonies were selected, inoculated into liquid LB supplemented with kanamycin (25 μg/mL), and further incubated overnight at 37°C in a shaking incubator at 220 rpm. After 16 hours of incubation, the cell culture was pelleted, and the plasmids extracted.

Phage production

We had the opportunity to assess our ability to produce M13 engineered phage particles using an optimized protocol. This experiment allowed us to confirm if the phagemid pTZ19R and the helper phage M13CP are able to produce M13 phage particles, once co-transformed in a packaging cell called E. coli DH5ɑ.

Another experiment for phage production was carried out using an optimized protocol to co-transform the phagemid pTZ19R and the helper plasmid pSB3KM13 in E. coli TOP10 F’.

Transduction and specificity assay

With the aim of demonstrating the capability of the produced engineered phages to infect E. coli TOP10 F’ and transduce the phage genome in the cell, we performed a transduction assay. For this purpose the phagemid was cloned, between prefix and suffix, with an RFP expression cassette. This allows us to quickly confirm the occurrence of the transduction process.

To test the specificity of the phage infection, we tried to infect E. coli TOP 10 and A. baumannii with the produced engineered phages.

Alternative G3 genes

Bioinformatic analysis

Bioinformatic analysis of TolA protein (UniProt ID: P19934) homologues was performed using the BLASTp tool with pre-set parameters, except for the “max target sequences” set at 250 hits and the exclusion of Escherichia coli as a target organism.

A surface protein of Klebsiella pneumoniae, called "cell envelope integrity protein TolA" (NCBI ID: MBS4159696.1), was specifically identified, sharing 100% similarity with the TolAIII domain of E. coli (residues 305-421[2]). For this reason, using the online tool available at Benchling.com, the sequence of M13 gene 3 was imported and modified to delete the region spanning aminoacidic residues 87 to 256, making it, thus, able to interact only with TolA and its homologues. Meanwhile, using the NCBI Taxonomy browser the Pf3 bacteriophage of Pseudomonas aeruginosa (NCBI:txid10872) was identified as part of the Inoviridae family. From the NCBI genome database the deposited genome of this phage was identified (ID: NC_074763) and from it, the gene 3 imported on Benchling.com to further process the sequence.

Before assembling the expression cassettes for the tropism determinants genes, on the coding sequences of the Gp3 gene of M13 deleted of the N2 domain, and the Gp3 gene of Pf3 phage, the codon optimization was performed utilizing two bioinformatic tools absolving different purposes. Using CODONATOR 3000, developed by the Sydney Australia iGEM Team in 2019 we were able to harmonize the codon usage for the target species (E. coli). The optimization was chosen according to the relative proportion in which the starting codon is translated into the codon of E. coli, based on the most similar frequency of occurrence, considering the bias in amino acid appearance. Subsequently the IDT Codon Optimization Tool was used aiming to eliminate repeated sequences and low complexity regions that could complicate the synthesis process. Using the same algorithm, a total of four forbidden restriction sites, present in the two sequences, were also deleted, to ensure compatibility with the BioBrick standard.

Using the Benchling.com online platform the expression cassettes for the tropism determinants genes have been assembled joining promoters, coding sequences (CDS) and terminators. Once designed and optimized, the sequences were synthetized by IDT Technologies.

Cloning

With the aim of cloning the alternative G3 genes sequence, an amount of 800 ng of both G3_M13_Cut_optimized and G3_Pf3_optimized were each digested in four parallel reactions using EcoRI and PstI restriction enzymes. After the incubation, all the samples were purified using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, Wisconsin, USA) by following manufacturer’s instructions. At the same time, the standard helper plasmid, BBa_K4727002, was also digested with the same enzymes, to open a gap between the prefix and the suffix allowing the insertion of the newly synthesized gene. The sample was run in gel electrophoresis, the corresponding band excised and purified.

The purified vector and the inserts were then ligated together, employing different ratios of insert over vector to ensure a higher output. The resulting ligation products were transformed into E. coli MG1655 Z1 chemically competent cells and then plated on LB agar supplemented with kanamycin (25 μg/mL) in order to select the successfully transformed cells. After overnight incubation at 37°C, colonies containing the desired DNA sequences were identified and picked. The selected colonies were then inoculated into liquid LB medium containing kanamycin (25 μg/mL) and allowed to grow for 16 hours at 37°C in a shaking incubator at 220 rpm. Subsequently, the cell cultures were harvested and subjected to plasmid DNA extraction to isolate the plasmids containing the desired sequences, whose presence and integrity were assessed (as always by gel screening and sequencing).

The Actuator target was to engineer plasmids to carry a CRISPR interference system (CRISPRi) with the aim to silence genes involved in antibiotic resistance. In particular we want to design two plasmids: pPAC that is specific for P. aeruginosa and pSAGb that is specific for A. baumannii and K. pneumoniae.

CRISPRi

For the realization of the CRISPRi system there are three substantial elements: one is the choice of the target genes that have to be silenced, another is the dCas9 enzyme and the last is the single guide RNA design.

Target genes

We decided to target genes involved in the antibiotic resistance, bacterial metabolism and in the biofilm production in order to restore bacterial susceptibility to antibiotics commonly used and enable their better absorption. The research of the different target for each KAPE strain was first performed in literature and then, with the help of bioinformatics tools such as NCBI BLAST, the presence of the selected genes in the ATCC bacteria strains genomes (the ones we use during all the laboratory activities) was confirmed. In the design, we report informations regarding these genes that also can explain the main reasons under our choices.

dCas9 (BBa_K4727008)

In order to generate a dCas9 gene compatible with the Standard BioBrick (RFC [10]) the Quick Protocol for Q5® Site-Directed Mutagenesis Kit (from New England Biolabs™) was used for the PCR mutagenesis of the EcoRI site inside the dCas9 coding sequence carried by the plasmid J116-dCas9_3k3 (Bellato et al., 2022 [3]). The used protocol includes some points that may depend on different specific cases and operator’s choices, and only those specific cases and choices are explicitly reported below, as well as any optimizations and variations made to them during the transformation phase of the E. coli TOP10 chemocompetent cells.

• The Forward and Reverse Primers used for the PCR were designed on Benchling.

  FW primer: GACTTTTCGAATcCCTTATTATGTTGGTC
  RV primer: AAGATTTTTTCAATCTTCTCACGATTGTCTT
  

  They are non-overlapping and the point mutation, responsible for creating a mismatch between the Template DNA and a cytosine at the position 13 5'-end of the Primer itself, is present in the Forward Primer.

• The Template DNA was obtained from a colony inoculated on 5 ml LB+kanamycin [25 μg/mL] starting from the stock at -80°C of E.coli harboring the plasmid J116-dCas9_3k3. The inoculum was incubated at 37°C 220 rpm O/N. The next day, plasmid DNA was extracted and quantified.
• After gel visualization, the sample with the best quality was selected for setting up the KLD reaction (Kinase, Ligase and DpnI enzymes) with 2X KLD Reaction Buffer, 10X KLD Enzyme Mix and 10X KLD Enzyme Mix; the reaction was incubated for 5-minute.

The obtained sample was transformed into competent E. coli TOP10 cells. After the transformation, 100 μl of the bacterial solution have been plated on a pre-warmed LB agar plate with kanamycin [25 μg/mL], while the rest of the volume was centrifuged at 10000 rpm for 1 min; about 1 ml of the resulting supernatant was discarded and the pellet was resuspended in the remaining liquid, thus concentrating the cells. The entire volume has been plated on another prewarmed LB agar plate with kanamycin [25 μg/mL] and the two plates were incubated at 37 °C O/N or until colonies appeared. From these plates we performed pick and inoculum to extract plasmid DNA and sequence it to ensure the correct mutation.

sgRNAs

This section reports the general approach adopted for the sgRNA design, describing how the tools have been exploited for each target gene of the ATCC 19606 (Acinetobacter baumannii strain 2208 [81, DSM 6974]), 13883 (Klebsiella pneumoniae subsp. pneumoniae strain NCTC 9633) and 10145 (Pseudomonas aeruginosa (Schroeter)) strains. Furthermore, the main parameters of interest, associated with the usage of the tools for a CRISPR interference application (setting on SpdCas9, guides equal to the non-coding DNA strand, distance from the TSS, GC content, off-targets, efficiency, self-complementarity) are indicated.

Benchling settings:

• select the Target Region (the CDS of interest) inside the uploaded bacterial genome;
• use the preset; settle Genome on “GCA_002136865_EnsemblRelease_53 (Acinetobacter baumannii)” or “KPBAA1705_01152013 (Klebsiella pneumoniae ATCC BAA-1705)” or "GCA_000006765.1(Pseudomonas aeruginosa PAO1)";
• search for a guide with the highest On and Off-Target Scores (above 60.0 is better according to the instructions of the site itself), and nearest to the TSS of the gene (within the first 20% of the sequence); if the coding sequence is on the positive strand (5’-3’), the guide must be on the strand (3’-5’), otherwise the opposite.

CHOPCHOP settings:

• paste the Target sequence (if the CDS is on the negative strand, paste the Reverse complement);
• use the preset; select “Acinetobacter baumannii ATCC 19606 (ASM1139851v1)” or “Klebsiella pneumoniae str. SGH10 (CP025080)” or "Pseudomonas aeruginosa PAO1 (GCF_000006567.1)", “CRISPR/Cas9” and “repression”; settle Target specific region of gene on “Coding region”; filter for Minimum required GC content has to be between min: 30% and max: 70%;
• search for a guide coded by the negative strand (-), nearest to the TSS of the gene (within the first 20% of the sequence), which should have the lowest Self-complementarity and number of off-targets (with 0, 1, 2 or 3 mismatches), and the highest Efficiency.

Cas-Designer settings:

• paste the Target sequence (if the CDS is on the negative strand, paste the Reverse complement);
• use the preset; select “Acinetobacter baumannii (ASM151871v1)” or “Klebsiella pneumoniae str. ATCC 43816 (ASM1607173v1)” or “Pseudomonas aeruginosa PAO1 (ASM676v1) - g-proteobacteria”;
• search for a guide coded by the negative strand (-), nearest to the TSS of the gene (within the first 20% of the sequence) and with the lowest number of off-targets (with 0, 1 or 2 mis-matches).

CRISPOR settings

• paste the Target sequence (if the CDS is on the negative strand, paste the Reverse complement);
• use the preset; select “Acinetobacter baumannii ATCC 19606” or “Klebsiella pneumoniae ATCC 43816 (ASM1607173v1)” or "Pseudomonas aeruginosa str. PAO1 - NCBI GCF_000006567.1 (ASM676v1);
• search for a guide in the reverse Strand (“rev”), nearest to the TSS of the gene (within the first 20% of the sequence) and with the lowest number of offtargets (with 0, 1, 2, 3 or 4 mis-matches), especially if next to PAM.

The reported sequences of any off-targets in all the tools have been aligned with the genomes of the bacteria to verify that it is not the guide itself instead of an actual off-target, then the position and binding strength with respect to the offgene are evaluated.

pPAC (BBa_K4727001)

The first step of the development process to obtain pPAC, we wanted to build a non-BioBrick plasmid expressing RFP having parts suitable for P. aeruginosa. We decided to perform a Gibson assembly using the NEBuilder® HiFi DNA Assembly Cloning Kit. This first assembly was performed using three fragments, one for each plasmid, as it follows.

• pUCP20 PilB was used to get the backbone pUCP20. These are the primers used for the isolation:

  Backbone FW: atcctgacggatggccttttaACCGCGTGACCAAGGATAG
  Backbone RV: acgtcttcggaggaagccatAGCTGTTTCCTGTGTGAAATTG
  

• pMF230 was amplified in order to obtain the terminators (rrnbT1 and T2) region. These are the primers used for the isolation:

  Backbone FW: actccaccggtgcttAATAAGCTTGGCTGTTTTGGCGGAT
  Backbone RV: ctatccttggtcacgcggttAAAAGGCCATCCGTCAGGAT
  

• RFP gene (BBa_E1010) from BBa_I13507 was amplified and assembled together with the backbone from pUCP20 PilB and the terminators from pMF230. These are the primers used for isolation:

  FW: atttcacacaggaaacagctATGGCTTCCTCCGAAGACGT
  RV: atccgccaaaacagccaagcTTATTAAGCACCGGTGGAGTG
  

These three fragments were assembled in a temporary plasmid called pUCP20_RFP_rrbT12. To ensure the success of the assembly, the plasmid is sequenced. For sequencing, the service of Eurofins Genomics is used.

In the earlier stage of the activities, we thought that we would be able to use ampicillin as a selection marker for the transformation of P. aeruginosa; so we developed this non-BioBrick plasmid to test the expression in this bacteria, so we could proceed both with the optimization of the electroporation protocol and with the plasmid development. However, during the first attempts of transformation, we noticed that the tolerance of the bacteria to this antibiotic was canceling our efforts. So we realized that we needed to change the selection marker gene from ampicillin to chloramphenicol, which is the only antibiotic allowed in the competition to which this strain is sensible.

So, the second step was the standardization of the plasmid pUCP20_RFP_rrbT12 in a BioBrick. To standardize the plasmid, we added prefix and suffix sequences between the promoter pLac (from pUCP20 PilB) and the terminators rrnbT1 and rrnbT2 (from pMF230). This was performed using insertion mutagenesis (Q5 Site-directed Mutagenesis Kit by NEB). The plasmid in this phase was called pUCP20 standard. The primers used for mutagenesis are:

After sequencing, it emerged that during this mutagenesis, the RFP gene was lost, so it will be necessary to clone it using digestion ligation, according to the BioBrick standard.

Then, the selection marker was substituted (from Ampicillin to Chloramphenicol) to obtain the final plasmid, pPAC. We performed a second Gibson assembly using the following fragments.

• pUCP20 standard was used to get the backbone. These are the primers for the isolation:

  Backbone FW: gtgagttgattgctacgtaaCTGTCAGACCAAGTTTACTCA
  Backbone RV: cccgtgatttttttctccatACTCTTCCTTTTTCAATATTATTGAAG
  

• pSB4C5 (standard backbone) was used to get the gene for chloramphenicol acetyl-transferase (CAT) for the chloramphenicol resistance. These are the primers for the isolation:

  CAT FW: aatattgaaaaaggaagagtATGGAGAAAAAAATCACGGG
  CAT RV: gagtaaacttggtctgacaaTTACGTAGCAATCAACTCACT
  

The Gibson product was sequenced. The backbone obtained is then registered in the iGEM registry and is intended to be used for the expression in P. aeruginosa.

As mentioned before, the next step is to clone the RFP cassette from BBa_I13507 in the backbone pPAC. We digested both the vector and the insert with the enzymes EcoRI and PstI, performing a directed cloning. The plasmid thus obtained was called pPAC507.

pSGAb (BBa_K4727000 and BBa_K4727009)

First, as previously mentioned in the Design section of Actuator, we wanted to standardize the pSGAb plasmid as a BioBrick. In order to insert the prefix and suffix sequences into the pSGAb-km plasmid, a digestion reaction was performed to remove the J23119 promoter (containing a SpeI restriction site) and the Multiple Cloning Site. Specifically, the restriction reaction was set up using the HindIII and SacI restriction enzymes. After the gel separation in 1% agarose and extraction of the expected band, a ligation reaction was carried out between the resulting backbone and the insert (depicted below), which was synthesized by Eurofins Genomics (Milan, Italy) and possessed compatible ends.

The Prefix and Suffix are located in the upstream (5') and downstream (3') regions of this sequence, respectively flanked by HindIII and SacI cutting sequences. The two terminal regions of the insert contain 6 bps necessary to ensure proper recognition of the digestion sequence by the restriction enzyme. The synthetized region also contains the standard promoter BBa_J23119. The resulting plasmid was named pSGAb iGem (BBa_K4727000).

Next, with the aim of cloning a rfp expression cassette, a second enzymatic digestion reaction was performed using the SpeI and PstI enzymes (back insertion).. The resulting fragment was then subjected to a ligation reaction with the iGEM BBa_I13521 cassette.

In second instance, a similar ligation reaction with the iGEM BBa_I13507 was attempted, cloning the expression cassette for the RFP in the same way as previously described

In a final attempt, we performed the substitution of BBa_J23119 with the entire BBa_I13521cassette by digesting both backbone and insert with EcoRI and PstI.

All the ligated products described for pSGAb-km were transformed in E. coli TOP10 chemically competent cells: the plasmid with I13507 was then sequenced to confirm the successful cloning and then transformation in A. baumannii, while the one bearing I13521 seems to be incapable of expressing the reporter gene, maybe due to the presence of a double promoter upstream the RFP gene.

Mutation Rate assessment in A. baumannii

As we noted a high biological variability in the RFP expression in A. baumanni, we wanted to assess an eventual mutation rate of the reporter gene in the non-model species. For this we set up a mutation rate-experiment. A. baumannii cells bearing BBa_K4727000 cloned with the I13507 expression cassette were plated on selective LB plates (LB+25ug/mL Kan). After an overnight incubation, red and white colonies were counted and a red colony was inoculated in liquid LB broth. After 16h of growth, cells were again plated and incubated overnight. The following day red and white colonies were counted. To calculate the mutation ratio, pick and inoculum series were carried on for 2 weeks.

Changing the ORI

As we were not able to successfully clone a dCas9 expression cassette in pSGAb and to obtain viable E. coli colonies, we decided to change the origin of replication (ORI) from the high copy pMB1/pUC19 to the low copy p15a. This change was made by Gibson assembly using the following fragments.

• pSGAb iGem was used to extract the backbone without pMB/pUC19. The following primers have been used for the isolation:

  FW: caagaagatcatcttattaagaaGATCCTTTGATCTTTTCTACGGGGTCTG
  RV: agccagtatacactccgctaAACGCCAGCAACGCGGCCTT
  

• A pSB3K3 standard backbone was used to extract the new ORI p15a. The following primers have been used for the isolation:

  FW: aaggccgcgttgctggcgttTAGCGGAGTGTATACTGGCT
  RV: gaaaagatcaaaggatcttcTTAATAAGATGATCTTCTTGAGATCG
  

After verifying the successful exchange of the ORI we registered this new part as BBa_K4727009. Following this we wanted to clone the dCas9M (CDS: BBa_K4727008) with its expression cassette. For this aim we digested the new ORI pSGAb (BBa_K4727009) and J116-dCas9_m_3k3 (PCR mutagenesis results in theResults section) with EcoRI and PstI, then we separated the fragments on agarose gel, excised and extracted the ones of interest, pSGAb iGem and dCas. A ligation reaction was performed and the product was transformed into E. coli TOP10.

Protocols

To reach these goals, we performed the experiments by using the protocols below. Some of the standard protocols, such as the ones for the transformation by electroporation, were implemented to be functional for our aims.

Buttons: (divided the protocols by task and link them)

Basic activities:

PCR

Phage

Transformations

E. coli

A. baumannii

K. pneumoniae

P. aeruginosa

References

1. Chasteen, L., Ayriss, J., Pavlik, P. & Bradbury, A. R. M. Eliminating helper phage from phage display. Nucleic Acids Res. 34, e145–e145 (2006).
2. Levengood, S. K., Beyer, W. F. & Webster, R. E. TolA: a membrane protein involved in colicin uptake contains an extended helical region. Proc. Natl. Acad. Sci. 88, 5939–5943 (1991).
3. Bellato, M., Frusteri Chiacchiera, A., Salibi, E., Casanova, M., De Marchi, D., Castagliuolo, I., Cusella De Angelis, M. G., Magni, P., & Pasotti, L. CRISPR Interference Modules as Low-Burden Logic Inverters in Synthetic Circuits. Frontiers in Bioengineering and Biotechnology, 9, 743950 (2022).