Experiments

1. 150 mL of BHI + v2 salts(supplement 1) is inoculated directly from a glycerol stock of V. natriegens and incubated at 37 °C with agitation at 200 r.p.m. to an OD600 of 0.4 (~2 h).

(All subsequent steps are performed quickly at room temperature. )

2. The culture is split into three 50-mL conical tubes, and centrifugated at 3,000 × g for 5 min.

3. Remove the supernatant carefully and gently suspend the precipitation with 5 mL 100 mM MgCl2.

4. Consolidate the cells into two 50-mL conical tubes, and the volume in each tube is brought up to 30 mL with 100 mM MgCl2 and mixed by gentle inversion.

5. Centrifugation at 3,000 × g for 4 min.

6. Suspend the precipitation in 5 mL 100 mM CaCl2, consolidate them into one tube, and then brought the volume up to 30 ml with additional 100 mM CaCl2.

7. Mix the tube gently by inversion and then incubate it at room temperature for 20 min.

8. Centrifugation at 3,000 × g for 4 min.

9. Remove the supernatant, and the cells are resuspended in ~1.5 mL . The cells are then aliquoted into chilled tubes, frozen in a dry ice bath, and stored at −80 °C until use.

1. Take a vial of competent cells and thaw it on ice.

2. Add the plasmid into 50 μL of competent cells and gently mix them, then incubate on ice for 20–30 min.

(During incubation, 1 mL BHI + v2 salts without antibiotics is warmed to 37 °C in a water bath.)

3. The cells and DNA are incubated at 42 °C for 45 s in a water bath and returned to ice for 2 min.

4. 37 °C-warmed medium is used to transfer the cells out of the microcentrifuge tube and into the culture tube.

5. Once transferred, the culture tube is maintained in a 37 °C water bath for 1 min and then allowed to recover by being incubated at 37 °C for 2 h with an agitation of 200 rpm. Cell dilutions are plated on warmed selective plates and incubated overnight at 37 °C.

1. Inoculate DH5α strain in LB liquid medium overnight;

2. Expanded inoculation in 3mL LB liquid medium at a ratio of 1:100 until OD600 ≈ 0.5 (about 2 hours);

3. Ice bath for 20 min;

4. Take 1mL of bacterial solution, centrifuge at 5000 rpm, 4℃ for 5min, repeat 3 times;

5. Discard the supernatant, carefully resuspend the bacterial precipitate with 1mL of 1M CaCl2 and incubate on ice for 30 min;

6. Centrifuge at 5000 rpm, centrifuge at 4℃ for 5min;

7. Discard the supernatant, carefully resuspend the bacterial precipitate with 200 μL 1M CaCl2, equally divided into 2 centrifuge tubes, which can be stored at -80℃ by adding 50% glycerol at 1:1.

1. Take 100μl of the competent cell from -80℃ then thaw it on ice.

2. Add plasmid DNA solution (5μL about 600ng), mix gently and leave on ice for 30 minutes.

3. Heat shock at 42℃ water bath for 90 seconds. After heat shock, quickly put on ice to cool for 2 minutes.

4. Add 1ml of LB liquid medium (without antibiotics) into the tube, mix and incubate at 37℃ for 1 hour to recover.

5. Cell dilutions are plated on warmed selective plates and incubated overnight at 37 °C for the colonies to appear.

1. 100μL of seed solution was inoculated in 50mL LB+v2(supplement 1) liquid medium and incubated at 37℃, 250RPM until OD600=0.4-0.6.

2. The bacterial solution was transferred to a pre-cooled 50mL centrifuge tube and ice-bathed for 5 mins.

3. Centrifuge at 4℃, 2000RCF for 5 mins, and discard the supernatant.

4. The bacterial precipitate was gently resuspended in 1mL pre-cooled 1M sorbitol buffer.

5. Centrifuge at 5000 RCF for 5 mins at 4℃ and discard the supernatant.

6. The bacterial precipitate was gently resuspended in 1mL pre-cooled 1M sorbitol buffer.

7. Centrifuge at 5000 RCF for 5 mins at 4℃, and discard the supernatant.

8. The bacterial precipitate was gently resuspended in 250 μL pre-cooled 1 M sorbitol buffer.

9. Dispense 50μL into each tube and store the tubes at -80℃ until use.

1. A vial of electrocompetent cell (50 μL) is retrieved from storage at -80 °C and thawed on ice.

2. About 100ng plasmid is added into the cell and the 1.5 mL centrifuge tube is incubated on ice for 3 mins.

3. The mix is gently transferred into chilled electroporation cuvette with a 0.1-cm gap size and allowed to stand for three minutes.

4. Cells are electroporated at a voltage of 790v and a constant time of 4ms (Bio-Rad,MicroPulserTM).

5. The cells are immediately transferred into 1 mL chilled LB+v2 salts medium and cultured at 37℃ with agitation at 250 r.p.m for 1 h.

6. 50 μL of the recovery culture is plated out on a warm agar plate with appropriate antibiotic.

7. The plate is incubated at 37℃ overnight for the colonies to grow.

1. Preparation of culture medium：

Add 2 mL LB+v2 salts medium with appropriate antibiotic (supplemet note 2) into several 15 mL centrifuge tubes (according to the number of colonies) and prewarm the medium at room temperature.

2. Preparation of PCR mix: for 50 μL PCR

Component	Volume
2×Taq Master Mix（dye plus）	25 μL
ddH2O	20 μL
Forward primer(10 μM)	2 μL
Reversed primer(10 μM)	2 μL

3. A small colony is suspended in the PCR mix, and the pipette tip is tipped into the medium with appropriate antibiotic.

4. Culture medium with the pipette tip is cultured at 37 ℃ with an agitation of 210 r.p.m.

5. Set up the PCR program:

Step	Temp(℃)	Time	Cycles
Initial denaturation	95	3 min	1
denaturation	95	15 sec	20-35
annealing	Tm-2 ℃	15 sec	20-35
extension	72	60 sec/kb a	20-35
Final extension	72	5 min	1
cooling	4	20 min	1

a: For 2× Phanta Flash Master Mix(Dye Plus), the extending speed is 5 sec/kb.

6. Choose appropriate culture according to the PCR result to conduct the following experiments.

1. 2 mL LB+v2 salts with an Ampicilin concentration of 100 μg/mL is inoculated with V.natriegens containing appropriate plasmid and cultured at 37℃ with an agitation of 210 r.p.m overnight.

2. 60 mL of LB+v2 salts with 100 μg/mL of Ampicilin is inoculated with the overnight culture at a dilution of 1:100, and cultured at 37℃ with an agitation of 210 r.p.m for about 1.5 h till its OD600 reached 0.5.

3. Arabinose storage solution (1 M) is added to the culture at a dilution of 1:50 to induce the expression of pilin.

4. The culture is continuously incubated at 37 ℃ with an agitation of 210 r.p.m overnight to prepare for the harvest.

1. 2mL LB+v2 salts with 100μg/mL kanamycin is inoculated with V.natriegens containing appropriate plasmids and cultured at 37℃ with an agitation of 210 r.p.m overnight.

2. 60 mL LB+v2 salts with 100μg/mL of kanamycin is inoculated with the overnight culture at a dilution of 1:100, and cultured at 37℃ with an agitation of 210 r.p.m for about 1.5 h till its OD600 reached 0.5.

3. IPTG storage solution (50 mg/ml) is added to the culture at a dilution of 1:100 to induce the expression of SpdCas9.

4. The culture is continuously incubated at 37℃ with an agitation of 210 r.p.m for 5h to prepare for the harvest.

1. 60 mL of overnight culture is centrifuged at 4000×g for 15 min at 4 °C.

2. The cells are resuspended in 30 mL 150 mM ethanolamine buffer (pH 10.5).

3. The suspension is transferred into a warring blender.

4. Wash the centrifuge tube with 20 mL 50 mM ethanolamine buffer( which is also added to the blender) three times.

5. The 90 mL suspension was blended for 2 min at a low speed to shear pilus from the cells.

6. The contents of the blender are transferred to a centrifuge bottle along with a wash of the blender with 10mL of ethanolamine buffer.

7. The blended material is centrifuged at 5000×g for 30 min at 4 °C to remove the cells.

8. The supernatant is collected and Triton X-100 detergent is added to a final concentration of 6 mM to solubilize any remaining cellular debris.

9. The tube is shaken at 100 r.p.m at room temperature for 45 min.

10. Contents in the tube are added to a stirring filtration unit that has a membrane filter with a 100 kDa- molecular-weight cutoff .

11. Additional ethanolamine buffer is added to the mixture to yield a final 2 mM concentration of Triton X-100.

12. The mixture is filtered in nitrogen gas (1.5MPa)

13. The pilins are collected from the filter membrane by scraping the surface into 1mL water.

1. Sample preparation

a. Soluable bacterial native proteins:

extracted by Bacterial Active Protein Extraction Reagent.

b. Cell bodies:

1 mL of bacteria culture is transferred into a 1.5mL centrifuge tube and cells are pelleted at 10000 r.p.m for 1 mins.The cell pellets then are collected and resuspended with 80 μL ddH2O.

c. Purified pilus solution:

Pilus solution is prepared as described above.

2. protein loading buffer is added to the sample according to the volume.a

3. Mix the contents by vortexing and contrifuge the tube to get the contents at the bottom.

4. Heat the samples at 100 ℃ for 5 mins in metal bath to denature the proteins.

5. Gel preparation:

Tris-Gly SDS-PAGE gels are prepared for SpdCas9 analysis. Tris-tricine SDS-PAGE gels are prepared for pilin monomer analysis.

6. Load 10 µL of the prepared loading samples to the gel, and load 5 μL of prestained protein marker to the gel.

7. Run the gel at 80 v for about 30 mins until the samples reach the boundary between stacking gel and separating gel.

8. Run the gel at 150 v for about 60 mins until the Bromophenol blue reaches the bottom of the gel.

9. Take the gel out of the casting frame and put it in a tray.

10. Add about 30 mL of ddH₂O (accoring to the volume of the tray. Make sure that the gel is completely submerged in ddH2O) and heat in microwave till the water boils.

11. Put the tray on a shaker to incubate the gel for about 5 min.

12. Discard the water and add about 20mL of Coomassie brilliant blue R-250 solution into the tray, then put the tray on a shaker to incubate the gel for about 10 min.

13. Discard the Coomassie brilliant blue R-250 solution and add 20 mL of ddH2O. Put the tray on a shaker to incubate for about 10 min.

14. Discard ddH₂O and add 20 mL of destaining solution(supplement note 2) to wash the gel on a shaker 3 times(10 mins each time).

SDS-PAGE

1. SDS-PAGE protocols are the same as previously described in steps 1-9 of SDS-PAGE analysis.

wet transfer

1. Cut the upper right corner of the gel and PVDF membrane (0.22 μm) to mark their direction.

2. Activate the PVDF membrane in methyl alcohol for 20 sec.

3. Make the “sandwich” as follows: cathode-sponge-filter paper-gel-filter paper-sponge-canode. Keep the “sandwich” hydrated while making it to avoid the formation of bubbles between the layers.

4. Assemble the device and transfer the proteins at 200mA for 50 mins

5. Carefully put the membrane in a clean tray (make sure that the side containing proteins is upward) and stain the PVDF membrane in ponceau S staining solution for 10 mins, then wash the membrane with TBST several times until the protein bands appears.

Blocking and antibody incubation

1. Add 30 mL 5% skim milk solution to the tray and incubate the membrane on a shaker at room temperature for 1 h.

2. Discard the skim milk solution and wash the membrane with TBST three times, for 5 mins each time.

3. Discard TBST and add 10 mL primary antibody solution(diluted with TBST at 1:5000) to the tray, then incubate the membrane at 4 ℃ overnight.

4. Recycle the primary antibody solution and store it at 4 ℃.

5. Wash the membrane with TBST three times, for 5 mins each time.

6. Discard TBST and add 10 mL secondary antibody solution(diluted with TBST at 1:10000) to the tray, then incubate the membrane at room temperature for 1.5 h.

7. Wash the membrane with TBST three times, for 5 mins each time.

Image development (Chemiluminescence)

1. Mix equal volume of Luminol solution and eroxide solution to a total volume of 1 mL.

2. Discard TBST in the tray and add the mixture to the surface of the membrane.

3. Put the membrane into ChemiDoc MP system（Bio-rad）and develop the image according to instructions from the manufacturer.

Linearized plasmid self-association assembly

1. DNA fragment of the linearized plasmids is obtained by high-fidelity PCR reaction (reverse PCR) with the addition of homology arms.

2. Prepare the following reaction system on ice (Using ClonExpress Ultra One Step Cloning Kit V2):

Component	Volume
Linearized vector fragment	2x 1 μL (~2x100 ng)
2×CE Mix	5 μL
dd H2O	3 μL

3. Mix by gentle suction and beating with a pipette (do not shake to mix) and briefly centrifuge to collect the reaction solution at the bottom of the tube.

4. Incubate at 50°C for 5 mins; cool to 4°C or immediately put the tube on ice.

5. Thaw the cloned chemoreceptor cells on ice.

6. Add 5 -10 μL recombinant product to 100 μL competent cells, flick the wall of the tube to mix (do not oscillate to mix), and leave it on ice for 30 mins.

7. After heat shock in 42℃ water bath for 30 sec, immediately put the tube on ice to cool for 2 - 3 min.

8. Add 900 μl of LB liquid medium (without antibiotics) and shake the bacteria at 37°C for 1 h (200 - 250 rpm).

9. Ampicillin-resistant LB solid medium plates were pre-warmed in a 37°C incubator.

10. The plates were centrifuged at 5,000 rpm (2,500 × g) for 5 min and 900 μl of the supernatant was discarded. Bacteria were resuspended with the remaining medium and gently spread with a sterile applicator stick on plates containing ampicillin resistance.

11. The plates were inverted and incubated at 37°C for 12 - 16 h in an incubator.

BCA test

Concentration of pilA protein monomer was measured by 96-well ELISA plate method using BCA Protein Quantification Kit.

1. BCA working solution preparation: according to the number of samples, add 50 volumes of BCA Reagent A plus 1 volume of BCA Reagent B (50:1) to prepare the appropriate amount of BCA working solution. Mix them thoroughly.

2. Standard curve: Take a piece of ELISA plate and add reagents according to the data in the table below:

No.	0	1	2	3	4	5	6	7
Protein standard solution (μL)	0	1	2	4	8	12	16	20
ddH2O (μL)	20	19	18	16	12	8	4	0
BCA working solution(μL)	200	200	200	200	200	200	200	200
Corresponding protein content (μg)	0	1	2	4	8	12	16	20

3. Sample preparation: Dilute the protein sample to be measured with ddH2O to the appropriate concentration, take 20 μl of the sample and add 200 μl of BCA working solution.

4. After shaking and mixing, place the sample at 37℃ for 20 - 30 min.

5. Determine the absorbance value at A562 nm with an ELISA plate, and use the absorbance value without BSA as a blank control.

6. Plot the standard curve with protein content(μg) as the horizontal coordinate and absorbance value as the vertical coordinate.

7. According to the measured absorbance value, the protein content of the sample can be calculated based on the standard curve.

8. Calculate the protein concentration: Divide the protein content by the sample volume of 20 μl and multiply by the corresponding dilution factor to obtain the actual concentration of the sample to be tested.

Glycerol stock

1. Prepare an overnight culture of the strain to be stored with appropriate liquid medium(OD600=1~1.5).

2. Add 500 μL of prepared culture to 500 μL of 50% glycerol.

3. Mix gently and store the tube at -80℃ until use.

Gel Recovery Program

1. Cut off the gel containing the target DNA fragments. 100 mg of gel equals 100 μL of volume as a gel volume.

2. Add an equal volume of Buffer GDP. 55°C water bath for 10 min. Invert and mix during the water bath.

3. Centrifuge quickly and place the FastPure DNA Mini Columns-G in a Collection Tubes 2 mL collection tube, transfer ≤700 μL of lysate to the column, centrifuge at 12,000 rpm (13,800 × g) for 60 sec.

4. （If the volume of lysate is >700 μL, return the column to the Collection Tubes, and repeat step 3）

5. Discard the filtrate. Add 300 μL Buffer GDP to the column. Centrifuge at 12,000 rpm (13,800 × g) for 60 sec.

6. Discard the filtrate. Add 700 μL of Buffer GW (with anhydrous ethanol added) to the column. Centrifuge at 12,000 rpm (13,800 × g) for 60 sec.

Repeat step 5.

7. Discard the filtrate. Centrifuge at 12,000 rpm (13,800 × g) for 2 min.

8. Place the column in a 1.5 mL sterilized centrifuge tube, add 30 μL ddH2O to the center of the column, and leave for 2 min. Centrifuge at 12,000 rpm (13,800 × g) for 1 min. Store the DNA at -20 °C.

PCR Solution Recovery Program

1. Briefly centrifuge PCR products. Measure the volume and transfer to a 1.5 mL centrifuge tube. If the sample volume is less than 100 μL, replenish it to 100 μL with H2O.

2. Add 5 times the volume of Buffer GDP and mix by inversion or vortexing.

3. Place the column in a collection tube. Transfer ≤700 μL of the solvent to the column and centrifuge at 12,000 rpm (13,800 × g) for 60 sec.

(If the volume of lysate is >700 μL, return the column to the Collection Tubes, and repeat step 3)4.

4. Follow steps 5 - 8 of Gel Recovery Program.

1. culture mediums(1000 mL)

LB liquid medium:

Component	Amount
Yeast extract	5g
tryptone	10g
NaCl	10g

2x YT liquid medium:

Component	Amount
Yeast extract	10g
tryptone	16g
NaCl	5g

BHI liquid medium:

Component	Amount
Brain Heart Infusion Broth (Dehydrated)	38.5g

LB solid medium

Component	Amount
Yeast extract	5g
tryptone	10g
NaCl	10g
agar	15g

LB +v2 salts liquid medium:

Component	Amount
Yeast extract	5g
tryptone	10g
NaCl	129.34g (10g + 204mM×1L)
KCl	3.12g (4.2mM × 1L)
MgCl2	24g（23.14mM × 1L）
K2HPO4	30.6g (17.6mM × 1L)

BHI +v2 salts liquid medium:

Component	Amount
Brain Heart Infusion Broth (Dehydrated)	38.5g
NaCl	119.34g (204mM×1L)
KCl	3.12g (4.2mM × 1L)
MgCl2	24g（23.14mM × 1L）
K2HPO4	30.6g (17.6mM × 1L)

2.other reagents used

Coomasie brilliant blue destaining solution

Component	Volume
methanol	250 mL
glacial acetic acid	80 mL
ddH2O	To 1000 mL

transformation storage buffer(a modified version of the buffer of Inoue34 containing DMSO)

55 mM MnCl2, 15 mM CaCl2, 250 mM KCl, 10 mM PIPES (from 0.5 M, pH 6.7, stock), 7% (v/v) spec grade DMSO (where the DMSO is added after cells are suspended in the other buffer components)

Component	Concentration
MnCl2	55 mM
CaCl2	15 mM
KCl	250 mM
PIPES	10 mM (from 0.5 M, pH 6.7, stock)
DMSO (added after cells are suspended in the other buffer components)	7% (v/v)

3.antibiotic concentration

Ampicillin storage solution:100 mg/mL

Kanamycin storage solution: 100 mg/mL

Ampicillin for single resistance Vibrio natriegens liquid culture: 100 μg/μL

Kanamycin for single resistance Vibrio natriegens liquid culture: 100 μg/μL

Double resistance Vibrio natriegens liquid culture: Ampicillin 75 μg/μL;Knamycin 75 μg/μL

Ampicillin for single resistance E.coli liquid culture: 100 μg/μL

Kanamycin for single resistance E.coli liquid culture: 50 μg/μL

Ampicillin for LB solid medium(E.coli):50 μg/μL

Ampicillin for LB solid medium(V.natriegens):30 μg/μL

4.primers

name	function	sequence
PLF	Screening of transformants of pPilin by colony PCR	GTCTGAGCGGTTATCAGAGACAACAG
PLR	Screening of transformants of pPilin by colony PCR	ATTGTCCATATTGCATCAGACATTGCC
CRF	Screening of transformants of pdCas9-sg1 by colony PCR	GGCACAAATAGCGTCGGATGG
CRR	Screening of transformants of pdCas9-sg1 by colony PCR	GCATCTACTCCACTTGCGTTAATAGGG
GFF	Screening of transformants of pGFP by colony PCR	GCACAAGCTGGAGTACAACTTCAAC
GFR	Screening of transformants of pGFP by colony PCR	ATTTGTCCTACTCAGGAGAGCGTTC
CutF	pGFP modification(reverse PCR,deleting the pilin fragment from the N terminus of sfGFP)	CATGAGAAGGaagagagaGAAATCAatggtgagcaagggc
CutR	pGFP modification(reverse PCR,deleting the pilin fragment from the N terminus of sfGFP)	ctctcttCCTTCTCATGAGATAGATAATGC
ModF1	pGFP modification(reverse PCR,changing the position of initiation codon)	GAGAAGGaagagagaACGAAGTCAAATAAAC
ModR1	pGFP modification(reverse PCR,changing the position of initiation codon)	CTTCGTtctctcttCCTTCTCATGAGATAG
ModF2	pGFP modification(reverse PCR,changing the position of initiation codon)	GAATTAACGATCGTGGTGGCGGTAAT
ModR2	pGFP modification(reverse PCR,changing the position of initiation codon)	CCACCACGATCGTTAATTCAATCAGC

5.plasmids

plasmid	backbone	resistance	Function gene	promoter	RBS	terminator
pPilin	pUC19	Ampicillin	Recombined Pil_A	BBa_I0500	BBa_B0034	BBa_B1006
pGFP	pUC19	Ampicillin	Recombined sfGFP	V.natriegens promoter for pilA	V.natriegensRBS for pilA	BBa_B0010
pdCas9-sg1	pRSFDuet-1	Kanamycin	sgRNA;spdCas9	BBa_J23100(sgRNA); BBa_R0010(spdCas9)	BBa_B0034(spdCas9)	BBa_B1006