LB and YEPD Culture Media Preparation and E.coli Inoculation
Material
|
Reagent |
Volume/mass |
|
Tryptone |
30g |
|
Yeast Extract |
15g |
|
NaCl |
10g |
|
Glucose |
20g |
|
Agar |
6g |
|
ddH2O |
/ |
|
Carbenicillin |
1g |
|
Chloramphenicol |
250mg |
|
CCTCC M94055 (E.coli) |
5ul |
|
GA (E.coli) |
5ul |
|
TemA (E.coli) |
5ul |
|
pHCas9 (E.coli) |
5ul |
|
Apparatus |
Amount |
|
Constant temperature shaker |
1 |
|
Electronic balance |
2 |
|
Clean Bench |
1 |
Procedure
1. Mix 10g tryptone, 5g yeast extract, 10g NaCl and 3g agar (to solidify, if the LB media is liquid, then ignore agar) together to prepare LB culture medium.
2. Add ddH2Oure to 1L and do sterilization under 121℃ for 20 min.
3. Mix 20g tryptone, 10g yeast extract, 20g glucose and 3g agar (to solidify, if the YEPD culture media is liquid, then ignore agar) together to prepare YEPD culture medium.
4. Add ddH2O to the mixture to 1L and do sterilization under 121℃ for 20min.
5. Weigh 1g Carbenicillin, and mix it with 10ml ddH2O, do filtration sterilization, store the agent of 1ml each for Ampicillin of 100mg/ml.
6. Weigh 250mg Chloramphenicol, and mix it with 10ml ddH2O, do filtration sterilization, store the agent of 1ml each for Chloramphenicol of 25mg/ml.
7. Take 5ul cryopreserved E.coli CCTCC M94055, GA, TemA and pHCas9 respectively, inoculate them into test tube with 3ml liquid LB culture media.
8. Add 5ul antibiotic into each test tube with inoculated E.coli (Carbenicillin for GA and TemA, Chloramphenicol for CCTCC M94055, pHCas9). Culture the E.coli in constant temperature shaker under 37℃, 220rpm for 15h (12-18h interval is acceptable).
9. Add 50ul/ml mixture of E.coli and antibiotic to prepared plate with solid LB culture media in the clean bench, label them with E.coli name + antibiotic.
10. Placed the prepared E.coli in the bacterial incubator under 37℃
Plastid Extraction (CCTCC M94055, GA, TemA and pHCas9 plasmids)
Material
|
Reagent |
Volume/mass |
|
CCTCC M94055-CAM |
2ml |
|
GA-Amp |
2ml |
|
TemA-Amp |
2ml |
|
pHCas9-CAM |
2ml |
|
Buffer S1 |
1ml |
|
Buffer S2 |
1ml |
|
Buffer S3 |
1.4ml |
|
Washing Buffer (ethanol-containing) |
4ml |
|
Eluent |
200ul |
|
Apparatus |
Amount |
|
Centrifuge |
2 |
|
4℃fridge |
4 |
|
Water Bath Cauldron |
1 |
|
spin column |
4 |
|
Centrifuge Tube |
8 |
Procedure (For each group)
1. Take 2ml bacterial liquid (for example, GA-Amp) prepared, centrifuge it under 12000rpm for 1min, discard the supernatant liquid (for collecting bacteria).
2. Add 250 μl Buffer S1 taken from 4℃ fridge (for suspending the bacteria).
3. Add 250 μl Buffer S2, turn over the centrifuge tube mildly and sufficiently for 4-6 times till the solution is translucent (for sufficient lysate of bacteria), this step should be within 5 min.
4. Add 350μl Buffer S3, turn over the centrifuge tube mildly and sufficiently for 6-8 times, centrifuge it under 9000rpm for 1min.
5. Transfer the supernatant liquid to spin column, place the spin column into 2ml centrifuge tube, centrifuge it under 9000 rpm for 1min, discard the filtrate.
6. Take out the spin column, add 500μl Washing buffer, centrifuge under 9000 rpm for 1 min, discard the filtrate.
7. Repeat the Step 6.
8. Place the spin column back in the 2ml centrifuge tube, centrifuge it under 12000 rpm for 1min.
9. Take out and place the spin column into 1.5ml centrifuge, wait 1-2 min for volatilization of ethanol, add 50μl 60-65℃ Eluent solution to the center of the spin column.
10. Place the spin column in 60-65℃ water bath for 1-2 minutes, take it out and centrifuge it under 12000rpm for 1min.
PCR
Material
For X-2-GA plasmid:
PCR system:
#2mix contains dNTPs, Taq DNA polymerase, buffer, cofactor (mgcl2)
|
X-2-TEF1(429bp) |
Volume (μl) |
Name GA(1580bp) |
Volume(μl) |
Name X-2-ADH1t(216bp) |
Volume (ul) |
|
2mix |
25 |
2mix |
25 |
2mix |
25 |
|
X-2-TEF1-F1 |
2 |
ADH1t-GA-R1 |
2 |
GA-ADH1t-F1 |
2 |
|
GA-TEF1p-R1 |
2 |
TEF1p-GA-F1 |
2 |
X-2-ADH1t-R1 |
2 |
|
pH Cas9 |
1.5 |
GA |
1.5 |
CCTCC M94055 |
1.5 |
|
ddH2O |
19.5 |
ddH2O |
19.5 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
Total |
50 |
The primer sequences for PCR（X-2-GA-2）are as follows :
|
sequences(5'to3') |
|
|
GAPp-R1 |
ATatactcgagTCATTATCAATACTGCCATTTCAAAG |
|
GA-GAPp-F1 |
caatctgatcatTTTGTTTGTTTATGTGTGTTTATTC |
|
GAPp-GA-R1 |
CATAAACAAACAAAatgatcagattgaccgttttc |
|
CYC1t-GA-F1 |
cataactaattacatgattacaataattcgatcaacttg |
|
X-2-CYC1t-F1 |
atatagagctcgcaaattaaagccttcgagcgtcccaaaac |
|
GA-CYC1t-R1 |
gttgatcgaattattgtaatcatgtaattagttatgtcac |
|
Primer |
sequences(5'to3') |
|
X-2-TEF1p-F1 |
GATGGgtttaaaccatagcttcaaaatgtttctactc |
|
GA-TEF1p-R1 |
cggtcaatctgatcatcttagattagattgctatgc |
|
ADH1t-GA-R1 |
aatcataagaaattcgcttacaataattcgatcaacttg |
|
TEF1p-GA-F1 |
gcaatctaatctaagatgatcagattgaccgttttc |
|
X-2-ADH1t-R1 |
tttgcgagctcccggtagaggtgtggtcaataag |
|
GA-ADH1t-F1 |
tgatcgaattattgtaagcgaatttcttatgatttatg |
For XII-5-GA
PCR system:
|
Name XII-5-GAP(690bp) |
Volume (μl) |
Name GA(1579bp) |
Volume(μl) |
Name XII-5-CYC1t(278bp) |
Volume(μl) |
|
2mix |
25 |
2mix |
25 |
2mix |
25 |
|
GAPp-R1 |
2 |
GAPp-GA-R1 |
2 |
XII-5-CYC1t-F1 |
2 |
|
GAPp-F1 |
2 |
CYC1t-GA-F1 |
2 |
GA-CYC1t-R1 |
2 |
|
CCTCC M94055 |
1.5 |
GA |
1.5 |
CCTCC M94055 |
1.5 |
|
ddH2O |
19.5 |
ddH2O |
19.5 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
Total |
50 |
|
Name XII-5-TEF1p |
Volume (μl) |
Name XII-5-GA (1580bp) |
Volume (μl) |
Name XII-5-ADH1t (216bp) |
Volume (μl) |
|
2mix |
25 |
2mix |
25 |
2mix |
25 |
|
XII-5-TEF1p-F1 |
2 |
ADH1t-GA-R1 |
2 |
GA-ADH1t-F1 |
2 |
|
GA-TEF1p-R1 |
2 |
TEF1p-GA-F1 |
2 |
XII-5-ADH1t-R1 |
2 |
|
pH Cas9 |
1.5 |
GA |
1.5 |
CCTCC M94055 |
1.5 |
|
ddH2O |
19.5 |
ddH2O |
19.5 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
Total |
50 |
The primer sequences for PCR（XII-5-GA-2）are as follows :
|
sequences(5'to3') |
|
|
GAPp-R1 |
ATatactcgagTCATTATCAATACTGCCATTTCAAAG |
|
GA-GAPp-F1 |
caatctgatcatTTTGTTTGTTTATGTGTGTTTATTC |
|
GAPp-GA-R1 |
CATAAACAAACAAAatgatcagattgaccgttttc |
|
CYC1t-GA-F1 |
cataactaattacatgattacaataattcgatcaacttg |
|
XII-5-CYC1t-F1 |
ATATAactagtgcaaattaaagccttcgagcgtccc |
|
GA-CYC1t-R1 |
gttgatcgaattattgtaatcatgtaattagttatgtcac |
|
Primer |
sequences(5'to3') |
|
XII-5-TEF1p-F1 |
ACCGTgtttaaaccatagcttcaaaatgtttctactcc |
|
GA-TEF1p-R1 |
cggtcaatctgatcatcttagattagattgctatgc |
|
ADH1t-GA-R1 |
aatcataagaaattcgcttacaataattcgatcaacttg |
|
TEF1p-GA-F1 |
gcaatctaatctaagatgatcagattgaccgttttc |
|
GA-ADH1t-F1 |
tgatcgaattattgtaagcgaatttcttatgatttatg |
|
XII-5-ADH1t-R1 |
atttgcactagtccggtagaggtgtggtcaataagag |
For XI-2-temA
PCR system：
|
Name XI-2-GAP278bp |
Volume (μl) |
Volume XI-2-temA-1888bp |
Volume (μl) |
Name XI-2-CYC1t-273bp |
Volume (μl) |
|
2mix |
25 |
2mix |
25 |
2mix |
25 |
|
XI-2-GAPp-F1 |
2 |
D-GAPp-temA-F1 |
2 |
D-temA-CYC1t-F1 |
2 |
|
D-TemA-GAPp-R1 |
2 |
D-CYC1t-temA-R1 |
2 |
XI-2-CYC1t-R1 |
2 |
|
CCTCC M94055 |
1.5 |
TemA |
1.5 |
CCTCC M94055 |
1.5 |
|
ddH2O |
19.5 |
ddH2O |
19.5 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
Total |
50 |
|
Name XI-2-TEF1p-423bp |
Amount(μl) |
Name XI-2-temA-1886bp |
Amount(μl) |
Name XI-2-ADH1t-214bp |
Amount(μl) |
|
2mix |
25 |
2mix |
25 |
2mix |
25 |
|
D-temA-TEF1p-F1 |
2 |
D-ADH1t-temA-F1 |
2 |
XI-2-SacI-R1 |
2 |
|
XI-2-Mss1-R1 |
2 |
D-TEF1p-temA-R1 |
2 |
D-temA-ADH1t-R1 |
2 |
|
pH Cas9 |
1.5 |
temA |
1.5 |
CCTCC M94055 |
1.5 |
|
ddH2O |
19.5 |
ddH2O |
19.5 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
Total |
50 |
The primer sequences for PCR（XI-2-temA-2）are as follows :
|
Primer |
sequences(5'to3') |
|
XI-2-GAPp-F1 |
TataggcgcgccTCATTATCAATACTGCCATTTC |
|
D-temA-GAPp-R1 |
aaaggcgtcatTTTGTTTGTTTATGTGTG |
|
D-GAPp-temA-F1 |
CAAACAAAatgacgcctttcgtcctc |
|
D-CYC1t-temA-R1 |
taattacatgactatctccatgtgtcgac |
|
D-temA-CYC1t-F1 |
acacatggagatagtcatgtaattagttatgtc |
|
XI-2-CYC1t-R1 |
|
|
Primer |
sequences(5'to3') |
|
D-temA-TEF1p-F1 |
aaggcgtcatcttagattagattgctatg |
|
XI-2-Mss1-R1 |
TACCCgtttaaaccatagcttcaaaatgtttctactc |
|
D-ADH1T-temA-F1 |
aaattcgcctatctccatgtgtcgac |
|
D-TEF1p-temA-R1 |
taatctaagatgacgcctttcgtcctc |
|
X-2-Sac1-R1 |
tttgcgagctcccggtagaggtgtggtcaataag |
|
D-temA-ADH1t-R1 |
acacatggagataggcgaatttcttatgatttatg |
For X-3-temA
PCR system:
|
Name X-3--GAP278bp |
Amount(μl) |
Name X-3-temA-1888bp |
Amount(μl) |
Name X-3-CYC1t-273bp |
Amount(μl) |
|
2mix |
25 |
2mix |
25 |
2mix |
25 |
|
XI-2-GAPp-F1 |
2 |
D-GAPp-temA-F1 |
2 |
D-temA-CYC1t-F1 |
2 |
|
D-TemA-GAPp-R1 |
2 |
D-CYC1t-temA-R1 |
2 |
XI-2-CYC1t-R1 |
2 |
|
CCTCC M94055 |
1.5 |
TemA |
1.5 |
CCTCC M94055 |
1.5 |
|
ddH2O |
19.5 |
ddH2O |
19.5 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
Total |
50 |
|
Name X-3-TEF1p-423bp |
Amount(μl) |
Name X-3-temA-1886bp |
Amount(μl) |
Name X-3-ADH1t-214bp |
Amount(μl) |
|
2mix |
25 |
2mix |
25 |
2mix |
25 |
|
D-temA-TEF1p-F1 |
2 |
D-ADH1t-temA-F1 |
2 |
XII-5-Bcu1-R1 |
2 |
|
X-3-Mss1-R1 |
2 |
D-TEF1p-temA-R1 |
2 |
D-temA-ADH1t-R1 |
2 |
|
pH Cas9 |
1.5 |
temA |
1.5 |
CCTCC M94055 |
1.5 |
|
ddH2O |
19.5 |
ddH2O |
19.5 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
Total |
50 |
The primer sequences for PCR（X-3-temA-2）are as follows :
|
sequences(5'to3') |
|
|
XI-2-GAPp-F1 |
TataggcgcgccTCATTATCAATACTGCCATTTC |
|
D-temA-GAPp-R1 |
aaaggcgtcatTTTGTTTGTTTATGTGTG |
|
D-GAPp-temA-F1 |
CAAACAAAatgacgcctttcgtcctc |
|
D-CYC1t-temA-R1 |
taattacatgactatctccatgtgtcgac |
|
D-temA-CYC1t-F1 |
acacatggagatagtcatgtaattagttatgtc |
|
XI-2-CYC1t-R1 |
|
|
Primer |
sequences(5'to3') |
|
D-temA-TEF1p-F1 |
aaggcgtcatcttagattagattgctatg |
|
X-3-Mss1-R1 |
AGTGGgtttaaaccatagcttcaaaatgtttc |
|
D-ADH1T-temA-F1 |
aaattcgcctatctccatgtgtcgac |
|
D-TEF1p-temA-R1 |
taatctaagatgacgcctttcgtcctc |
|
XII-5-Bcu1-R1 |
atttgcactagtccggtagaggtgtggtcaataagag |
|
D-temA-ADH1t-R1 |
aaattcgcctatctccatgtgtcgac |
|
Apparatus |
Amount |
|
PCR |
1 |
Procedure in the form of PCR program setting chart
|
Step |
Temperature(℃) |
Time |
|
1 |
95 |
5min |
|
2 |
95 |
30sec |
|
3 |
55 |
30sec |
|
4 |
72 |
2min |
|
5 |
72 |
10min |
|
6 |
4 |
Forever |
Repeat Step2-4 for 30 times
Agarose Gel Electrophoresis
Material
|
Reagent |
Volume/mass |
|
TAE buffer |
/ |
|
Agarose |
1g |
|
Gel Red (nucleic acid dye) |
5ul |
|
DNA marker |
10ul |
|
Apparatus |
Amount |
|
Electrophoresis apparatus |
1 |
|
Microwave |
1 |
|
Erlenmeyer Flask |
1 |
|
Gel tray |
1 |
|
Blue light transilluminator |
2 |
Procedure:
1. Add 100ml TAE buffer into the Erlenmeyer Flask, weigh 1g agarose and place it into the Erlenmeyer Flask.
2. Heat the Erlenmeyer Flask in the microwave till the components melt completely. Take out and shake it well.
3. Add 5ul < nucleic acid Gel Red to the agarose gel.
4. Assemble the gel tray and comb. Pour the liquid gel mildly onto the gel tray, remove the bubble, insert a comb on a gel, wait for solidification of gel.
5. Take out the comb, transfer the solidified gel to the electrophoresis tank, add TAE buffer till the gel is immersed completely.
6. Add samples into each sampling hole respectively and record the order, add 10ul DNA Marker after adding samples.
7. Power on with 180 V for 15min.
8. Take out and place the gel under the blue light Transilluminator for observation.
Gel Extraction
Material
|
Reagent |
Volume/mass |
|
Buffer B3 |
250ul |
|
Washing solution |
1ml |
|
Elution buffer |
500ul |
|
Apparatus |
Amount |
|
centrifuge |
1 |
|
Vortex oscillator |
2 |
|
1.5ml centrifuge tube |
1 |
|
Absorption column |
1 |
Procedure
1. Cut out the target section from gel according to its position shown under blue light transilluminator.
2. Transfer the product to 1.5ml centrifuge tube, add 250μl buffer B3, vortex it on the vortex oscillator.
3. Transfer the mixture to the absorption column, centrifuge under 8000 rpm for 30 seconds, discard the filtrate.
4. Add 500μl Washing solution, centrifuge under 9000 rpm for 1min, discard the filtrate.
5. Repeat Step 4
6. Centrifuge under 9000 rpm for 1min.
7. Add 20μl Elution buffer into absorption film, place it under room temperature for 1-2 min, centrifuge under 9000 rpm for 1min, obtain the DNA.
8. Measure the concentration of DNA, store it under the temperature of -20 ℃.
Overlap Extension PCR (Over PCR)
Materials
For X-2-GA plasmid
PCR system:
|
Name X-2-GAP-GA-CYC1t-2485bp |
Amount(μl) |
Name X-2-TEF1-GA-ADH1-2160bp |
Amount(μl) |
|
2mix |
25 |
2mix |
25 |
|
GAPp-R1 |
2 |
X-2-TEF1p-F1 |
2 |
|
X-2-CYC1t-F1 |
2 |
X-2-ADH1t-R1 |
2 |
|
X-2-GAP |
1 |
X-2-TEF1 |
1 |
|
GA |
1 |
X-2-GA |
1 |
|
X-2-CYC1t |
1 |
X-2-ADH1 |
1 |
|
ddH2O |
18 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
The primer sequences for PCR（X-2）are as follows :
|
sequences(5'to3') |
|
|
GAPp-R1 |
ATatactcgagTCATTATCAATACTGCCATTTCAAAG |
|
X-2-CYC1t-F1 |
atatagagctcgcaaattaaagccttcgagcgtcccaaaac |
|
X-2-TEF1p-F1 |
GATGGgtttaaaccatagcttcaaaatgtttctactc |
|
GA-TEF1p-R1 |
cggtcaatctgatcatcttagattagattgctatgc |
|
|
|
For XII-5-GA plasmid
PCR system:
|
Name XII-5-GAP-GA-CYC1t-2485bp |
Amount(μl) |
Name XII-5-TEF1-GA-ADH1-2160bp |
Amount(μl) |
|
2 mix |
25 |
2mix |
25 |
|
GAPp-R1 |
2 |
XII-5-TEF1p-F1 |
2 |
|
XII-5-CYC1t-R1 |
2 |
XII-5-ADH1t-R1 |
2 |
|
XII-5-GAP |
1 |
XII-5-TEF1 |
1 |
|
XII-5-GA |
1 |
XII-5-GA |
1 |
|
XII-5-CYC1t |
1 |
XII-5-ADH1 |
1 |
|
ddH2O |
18 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
The primer sequences for PCR（XII-5）are as follows :
|
sequences(5'to3') |
|
|
GAPp-R1 |
ATatactcgagTCATTATCAATACTGCCATTTCAAAG |
|
XII-5-CYC1t-R1 |
atttgcactagtccggtagaggtgtggtcaataagag |
|
X-2-Sac1-R1 |
tttgcgagctcccggtagaggtgtggtcaataag |
|
D-temA-ADH1t-R1 |
acacatggagataggcgaatttcttatgatttatg |
|
|
|
For XI-2-temA
PCR system:
|
Name XI-2-GAP-GA-CYC1t-2804 bp |
Amount(μl) |
Name XI-2-TEF1-GA-ADH1-2160bp |
Amount(μl) |
|
2 mix |
25 |
2mix |
25 |
|
X-2-CYC1t-F1 |
2 |
X-2-Sac1-R1 |
2 |
|
XI-2-GAPp-F1 |
2 |
D-temA-ADH1t-R1 |
2 |
|
XI-2-GAP |
1 |
XI-2-TEF1 |
1 |
|
XI-2-GA |
1 |
XI-2-GA |
1 |
|
XI-2-CYC1t |
1 |
XI-2-ADH1 |
1 |
|
ddH2O |
18 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
The primer sequences for PCR（XI-2）are as follows :
|
Primer |
sequences(5'to3') |
|
X-2-CYC1t-F1 |
atatagagctcgcaaattaaagccttcgagcgtcccaaaac |
|
XI-2-GAPp-F1 |
TataggcgcgccTCATTATCAATACTGCCATTTC |
|
X-2-Sac1-R1 |
tttgcgagctcccggtagaggtgtggtcaataag |
|
D-temA-ADH1t-R1 |
acacatggagataggcgaatttcttatgatttatg |
|
|
|
For X-3-temA
PCR system:
|
Name X-3-GAP-GA-CYC1t-2804 bp |
Amount(μl) |
Name X-3--TEF1-GA-ADH1-2160bp |
Amount(μl) |
|
2 mix |
25 |
2mix |
25 |
|
XI-2-GAPp-F1 |
2 |
XII-5-Bcu1-R1 |
2 |
|
XII-5-CYC1t-R1 |
2 |
X-3-Mss1-R1 |
2 |
|
X-3--GAP |
1 |
X-3--TEF1 |
1 |
|
X-3--GA |
1 |
X-3--GA |
1 |
|
X-3--CYC1t |
1 |
X-3-ADH1 |
1 |
|
ddH2O |
18 |
ddH2O |
19.5 |
|
Total |
50 |
Total |
50 |
The primer sequences for PCR（X-3）are as follows :
|
sequences(5'to3') |
|
|
XI-2-GAPp-F1 |
TataggcgcgccTCATTATCAATACTGCCATTTC |
|
XII-5-Bcu1-R1 |
atttgcactagtccggtagaggtgtggtcaataagag |
|
X-3-Mss1-R1 |
AGTGGgtttaaaccatagcttcaaaatgtttc |
|
XII-5-CYC1t-R1 |
atttgcactagtccggtagaggtgtggtcaataagag |
|
|
|
|
Apparatus |
Amount |
|
PCR |
1 |
Procedure in the form of PCR program chart
|
Step |
Temperature（℃） |
Time |
|
1 |
95 |
5min |
|
2 |
95 |
30sec |
|
3 |
55 |
30sec |
|
4 |
72 |
2min |
|
5 |
72 |
10min |
|
6 |
4 |
Forever |
Repeat step 2-4 for 30 times
Restriction Endonuclease Digestion and Ligation
For X-2 restriction endonuclease digestion system:
|
Name
|
Amount(μl) |
Name |
Volume(μl) |
|
X-2 plasmid skeleton |
30 |
X-2-GAP-GA-CYC1t |
30 |
|
Cut Smart Buffer |
5 |
Cut Smart Buffer |
5 |
|
Xho1 |
1 |
Xho1 |
1 |
|
Sac1 |
1 |
Sac1 |
1 |
|
ddH2O |
13 |
ddH2O |
13 |
|
Total |
50 |
Total |
50 |
For XII-5 restriction endonuclease digestion system:
|
Name
|
Volume(μl) |
Name |
Volume(μl) |
|
XII-5 plasmid skeleton |
30 |
XII-5-GAP-GA-CYC1t |
30 |
|
Cut Smart Buffer |
5 |
Cut Smart Buffer |
5 |
|
Xho1 |
1 |
Xho1 |
1 |
|
Bcu1 |
1 |
Bcu1 |
1 |
|
ddH2O |
13 |
ddH2O |
13 |
|
Total |
50 |
Total |
50 |
For XI-2 restriction endonuclease digestion system:
|
Name
|
Amount(μl) |
Name |
Amount(μl) |
|
XI-2 plasmid skeleton |
30 |
XI-2-GAP-GA-CYC1t |
30 |
|
Cut Smart Buffer |
5 |
Cut Smart Buffer |
5 |
|
Sac1 |
1 |
Sac1 |
1 |
|
Sgs1 |
1 |
Sgs1 |
1 |
|
ddH2O |
13 |
ddH2O |
13 |
|
Total |
50 |
Total |
50 |
For X-3 restriction endonuclease digestion system:
|
Name
|
Volume(μl) |
Name |
Volume(μl) |
|
X-3 plasmid skeleton |
30 |
XI-2-GAP-GA-CYC1t |
30 |
|
Cut Smart Buffer |
5 |
Cut Smart Buffer |
5 |
|
Bcu1 |
1 |
Bcu1 |
1 |
|
Sgs1 |
1 |
Sgs1 |
1 |
|
ddH2O |
13 |
ddH2O |
13 |
|
Total |
50 |
Total |
50 |
Ligation PCR system:
|
Name
|
Volume(μl) |
|
Plasmid skeleton (eg. X-2) |
4 |
|
Inserted gene (eg. X-2-GAP-GA-CYC1t) |
16 |
|
T4 ligase |
1 |
|
T4 ligase buffer |
5 |
|
ddH2O |
25 |
|
Total |
50 |
|
Apparatus |
Amount |
|
PCR |
1 |
Procedure
1. Prepare restriction endonuclease digestion PCR system
2. Do restriction endonuclease digestion under 37℃ PCR for 30min.
3. Take out and reclaim the reagents, prepare the Ligation system according to the material chart.
4. Do Ligation under 16℃ PCR for 1.5 hours.
Competent cell preparation and Yeast Cell Transformation
Material
|
Reagent |
Volume/mass |
|
PEG 3350 (500g/L) |
240ul |
|
LiAc (1M) |
36ul |
|
Salmon sperm ssDNA(2ml/L) |
50ul |
|
ddH2O |
/ |
|
Peptone |
10g |
|
Beef extract |
5g |
|
NaCl |
5g |
|
Soluble Starch |
2g |
|
Agar |
15g |
|
1974 yeast cultured |
200ul |
|
YEPD culture media |
1ml |
|
DNA (GA+ temA) after Over PCR+ ddH2O |
34ul |
|
Sterile water |
25ml |
|
Apparatus |
Amount |
|
Nanodrop |
1 |
|
Centrifuge |
2 |
|
1.5ml Centrifuge Tube |
1 |
|
Box with ice |
1 |
|
Water bath |
1 |
|
Constant temperature shaker |
1 |
|
Constant temperature incubator |
1 |
|
Vortex oscillator |
2 |
|
Electronic Balance |
1 |
Procedure:
1. Dilute yeast liquid (over-night cultured) to 1/10 concentration, test OD600 of diluted liquid.
2. Transfer the diluted yeast liquid to 250 ml Erlenmeyer flask with 25ml 2*YEPD culture medium.
3. Culture the yeast under the temperature of 30℃, 240r/min in constant temperature shaker till its OD600 is 0.3-0.8.
4. 3000 rpm Centrifuge the yeast liquid for 5min for collecting yeast.
5. Add 25ml sterile water to suspend the yeast, 3000rpm centrifuge under the temperature of 20℃ for 5min.
6. Repeat the Step 5 twice.
7. Add 1 ml sterile water to suspend the yeast, transfer the yeast liquid to 1.5ml centrifuge tube, 12000rpm centrifuge for 30s, discard the supernatant liquid, collect the competent yeast cell.
8. Prepare components for LiAc transformation liquid reagent according to the chart.
|
Reagent |
Formula |
|
PEG 3350 (500g/L) |
25g PEG 3350 + 50ml ddH2O |
|
LiAc (1M) |
4.94g LiAc + 50ml ddH2O |
|
Salmon sperm DNA (2mg/L) |
0.02g ssDNA+10ml ddH2O. Place the 2mg/L ssDNA in 100℃ water bath for 5min, take it out and put it on the ice rapidly |
9. AddHO 240ul PEG 3350 (500g/L), 36ulLiAc (1M), 50ul ssDNA and 34 ul DNA (GA, temA) to centrifuge tube with competent cells in order.
10. Water bath the mixture under the temperature of 42℃ for 15min, 12000 centrifuge for 30 seconds, discard the supernatant liquid, add 1ml YEPD liquid culture media, suspend yeast, seal the opening.
11. Place it in the 240rpm constant temperature shaker under the temperature of 30℃ for 1 hour. 3000rpm Centrifuge for 4min, discard 600ul supernatant liquid.
12. Add 5g beef extract, 10g Peptone, 5g NaCl, 2g soluble starch and 15g agar, add ddH2O till the solution volume is up to 1 L, sterilize under 115℃ for 20min. (Preparation of soluble-starch solid culture media)
13. Evenly distribute the yeast on the plate with soluble-starch solid culture media, place the sealed plate up-side down in the incubator for two days under 30℃.
Ultrasonic Cell Disruptor
Material
|
Reagent |
Volume/mass |
|
Yeast GA-temA |
/ |
|
Yeast 1947 |
/ |
|
Protein extract solution |
15ml |
|
Apparatus |
Amount |
|
50ml centrifuge tube |
2 |
|
Ultrasonic Disruptor |
1 |
Procedure:
1. Transfer the yeast GA-temA and yeast 1974 to 50ml centrifuge tube, 8000rpm centrifuge for 5min, discard the supernatant liquid, add nutrition materials on the precipitate
2. 8000 rpm centrifuge for 5min, collect all the nutrition materials.
3. Add 15ml Protein extract solution (100mmol/L NaCl, 10mmol/L EDTA, pH8.0), use pipette to blow to suspend the precipitate.
4. Put the centrifuge tube on the test-tube stand, put the metal head of ultrasonic disruptor into the centrifuge tube, adjust the position of the tube, turn on the ultrasonic disruptor.
5. Ultrasonically disrupt the yeast with 80W Power for 2 seconds and 2 seconds of interval, 5 cycles once, the total disruption lasts for 20min.
6. 8000rpm centrifuge for 5min.
7. Take out centrifuge tube, carefully transfer the supernatant liquid to a new centrifuge tube, store under 4℃.
SDS-PAGE electrophoresis
Material
|
Reagent |
Volume/mass |
|
Yeast 1974 |
/ |
|
Recombinant yeast |
/ |
|
YPD-G418 liquid culture media |
50ml |
|
Protein buffer |
/ |
|
Apparatus |
Amount |
|
Centrifuge |
2 |
|
Water bath |
1 |
|
SDS PAGE |
1 |
|
Coomassie Blue Staining Kit |
1 |
Procedure:
1. Inoculate yeast 1974 and recombinant saccharomyces cerevisiae to 50ml YPD-G418 liquid culture media, culture them under 30℃, 240rpm in constant temperature incubator for 72 hours.
2. Add protein buffer into the supernatant liquid after centrifuge, 100℃ water bath for 5min for denaturation.
3. Do SDS-PAGE electrophoresis for recombinant GA-temA yeast and original saccharomyces cerevisiae 1974 under 130V for 30min for concentration, turn the volt to 90V and continue separation for 60min.
4. Dye the SDS-PAGE gel through Coomassie Blue Staining Kit.
Iodine Staining, Transparent Circle Observation and Enzymatic Activity Test
Material
|
Reagent |
Volume/mass |
|
Recombinant yeast GA-temA |
/ |
|
Yeast 1974 |
/ |
|
Iodine |
0.13g |
|
Iodide potassium |
0.35g |
|
ddH2O |
250 ml |
|
Citric Acid |
101g |
|
Sodium citric |
941g |
|
Starch |
0.2g |
|
Apparatus |
Amount |
|
Constant temperature shaker |
1 |
|
Nanodrop |
1 |
Procedure:
1. Mix 101g citric acid and 100ml ddH2O for preparation of citric acid solution A
2. Mix 941g sodium citric acid and 100ml ddH2O for preparation of sodium citric solution B
3. Weigh 27.5g solution A and 72.5g solution B, add 0.2g starch, adjust the pH value to 3, 4, 5, 6 and 7 respectively (soluble starch solution with different pH values).
4. Dissolve 0.13g iodine and 0.35g iodide potassium in 50ml ddH2O.
5. Add small amount of iodine solution to the soluble-starch solid culture medium with yeast 1974 and recombinant yeast GA-temA, observe the transparent circle.
6. Add original yeast 1974 and recombinant yeast GA-temA to soluble-starch solution with pH values of 3, 4, 5, 6 and 7 respectively.
7. Inoculate yeast 1974 and recombinant yeast GA-temA to 3ml YPD test, culture it under 30℃, 240rpm in the constant temperature shaker overnight.
8. Take the culture liquid and dilute it to 1/10 concentration, test the OD600 value through nanodrop.
9. Inoculate 200ul yeast liquid to 50ml YEPD liquid culture media, culture under 30 ℃, 240rpm in the constant temperature shaker for 72 hours.
10. Take proper amount of yeast liquid, 12000rpm centrifuge for 10min for enzymatic activity test.
Alcohol content determination
1.Yeast 100ul 1974 and 1974-GA-temA were added to 100ml YPD, and then 100 Amp was added, cultured at 37 °C for 24h, 36h, 72h.
2. The sample 12000Xg was centrifuged for 10 min, and the supernatant solution was taken to measure the alcohol content of 100ul 1974 and 1974-GA-temA with the alcohol Megazyme kit. ( Ethanol Assay Kit )