Background
NYU iGEM’s chosen project for this year is to construct a biomedical device that can measure the ferritin content in a patient’s system without the need to draw blood. The goal with this project is to make the at-home iron sensing device adaptable to different demographics, affordable, and easy to use. With this device being most closely geared towards patients with iron deficiencies/anemia, having a device that will not require mass amounts of time and money makes identifying, monitoring and assessing the health condition much more achievable than before. The problem of iron deficiency/anemia is very prevalent around the world, affecting close to 25% of the global population, and most heavily those of lower socioeconomic classes (Warner, 2022). Our project assesses this issue with the endeavor of engineered adaptability and accessibility, allowing a greater portion of those suffering from the previously mentioned health issue better access to important health tools.
Credit: Nataliia Mysak, iStock
Iron deficiency/anemia can be linked to many other health conditions and is very prevalent across the globe. It also is common in many sensitive groups such as children and women, along with lower socioeconomic classes (“Anaemia in Women and Children”, 2021). With the issue being so widespread and in need of engineered solutions, our team decided that it would not only be impactful for the sensitive groups affected, but also properly tie in synthetic biology, biomedical engineering, and global public health to create an impetus for other groups to tackle prevalent issues.
There are many other ways to currently test iron levels. Just for testing the ferritin marker, there are labs that can be done and some at-home test kits. However, as we mentioned earlier, so many communities are impacted by iron deficiency anemia and a lot of them don’t have access to doctors. The recent pandemic is a great example of how access to doctors could be limited for the larger public. This has been, and might unfortunately continue to be, a reality for many communities outside the impact of COVID. Along with the inaccessibility of medical professionals, patients relying on labs would have to visit the doctor every time they want to find out if their iron storage levels are sufficient. This takes up time and can be expensive. In addition, drawing blood is a painful process and is dangerous for people with iron deficiency anemia since blood loss results in lower iron levels in the body.
Credit: mixetto, iStock
The at-home iron testing kits on the market currently also tend to involve getting blood samples and/or are very expensive. Along with this, most of them are optical sensors that do not provide a quantitative output, so it is difficult for people to properly assess their iron levels. Pricking fingers or drawing blood at home also has a higher chance of risk than taking a saliva sample. After considering all of these current issues with testing iron levels, the NYU iGEM team is developing an at-home aptamer biosensor device to be used to detect iron levels from saliva samples. We hope to offer a less invasive and expensive option for people that gives more quantitative results.
About our Biosensor
The device uses a peptide aptamer that detects and binds to ferritin in saliva, and emits a fluorescent signal proportional to the concentration of the ferritin analyte. This is then read by an Arduino sensor that prepares the fluorescent signal to be displayed on a user interpretation system that can generate iron level results that the user can understand. Ferritin (structure image below) is a protein in cells that stores iron and releases iron when the body needs it. Ferritin levels reflect iron storage levels in the body. Ferritin deficiency causes low iron stores and higher ferritin levels means more iron is being stored in the body. Saliva contains ferritin at higher levels than serum. Therefore, iron storage levels in the body can be found using saliva samples. This biosensor device that uses saliva to detect iron levels allows for a quick and easy way for people to detect their iron levels at any time of the day.
Ferritin Structure
Credit: Wikipedia
According to low iron studies conducted by the National Heart, Blood, and Lung Institute, men need to have ferritin levels between 40 and 300, in order to be healthy, while women’s ferritin levels should lie between 20 and 200 to be a healthy range (NHIH 2023). Furthermore, ferritin levels less than 10 are considered unhealthy and considerable for iron-deficiency anemia. The biosensor device can be used to deliver iron levels to patients based on this scale to show them whether their ferritin levels are as high as they should be, and consequently, give them indications on their health statuses based on the projected ferritin measurement.
Previous Work
Peptide Aptamer:
In order to create a ligand that binds to ferritin, we’ve been looking at the binding sites of existing proteins that bind to ferritin. Some of the proteins we did further research on were transferrin receptor 1 (trf1) and H-kininogen (HK). We found that there was already a ligand that was made using H-kininogen’s site with ferritin (Coffman, 2009). This ligand (HKa) is a 22 amino acid chain that was found to bind with high affinity and specificity to ferritin. The paper (Coffman, 2009) explaining this finding used ligand blotting to test the HKa and ferritin binding. It was found that ferritin had a higher affinity with HKa (ligand) than with H-kininogen (HK). There were a few more assays conducted and discussed in the paper to test ferritin’s binding affinity to ferritin. While the researchers’ intent in testing this affinity is to test ferritin’s ability to increase angiogenesis by binding to HKa, the data they found is useful to our goal too. We plan to use computational docking and either fluorescent dot blot or ELISA assays to test the HKa ligand against ferritin in our lab and find a relationship between binding levels and iron levels. Below are images of our drawing of the ligand from chemdraw and Pymol. Please right click and open the image in a new tab to access them! It should take you to an imgbb image.
HKa Ligand in Pymol
HKa Ligand in Chemdraw (Not Energy Minimized)
Photo of HKa ligand after Chem3D Energy Minimization
We tested the peptide’s binding affinity with ferritin (heavy and light chains) using Autodock Vina and are now testing it in the Wet Lab using direct biotin-streptavidin ELISA.
DNA Aptamer:
Similar to our method of finding a peptide aptamer, we turned to an extensive literature review to find DNA in the body and in nature capable of binding to ferritin. Through our research, we found two papers (Broyles et al. and Surguladze et al.) that discuss DNA sequences capable of binding to ferritin. Interestingly, the sequences listed in both papers shared the same 6 bp motif. The Broyles paper also writes that they found this motif to be in all other sequences they tested and found to have some binding affinity to ferritin. Here are the sequences from each paper with the motif bolded:
Surguladze: “5′-GATCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTG-3′”
Broyles: “5’AACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGT3’”
When looking through the papers, we found that the Broyles paper had a bit more extensive research and comparative studies done to back its sequence’s binding abilities. That is why we decided to move onto the computational docking stage with the 5’-3’ strand from this paper (labeled as Wild Type Sequence in the paper) and its complementary 3’-5’ strand. We used Pymol to draw the structures and Haddock to energy minimize the oligos and test their binding affinity with heavy and light chain ferritin. We might do more computational work if possible to change out base pairs (while keeping the motif) to see which sequence binds best. We will also be testing the DNA aptamer in the wet lab through direct biotin-streptavidin ELISA and DNA shift assay (as used in the Broyles paper).
Inspiration From Other Work for the Biosensor:
We have taken inspiration from a few other publications and projects in order to reach our current progress. Detecting salivary iron levels is a relatively new diagnostic method. Most of the literature found for detecting iron levels in saliva have used laboratory based approaches. An automated chemiluminescent method was used to detect salivary ferritin levels in patients which showed that ferritin is present in quantifiable amounts in saliva and can be used as a diagnostic biomarker in detecting iron deficiency anemia (B, 2021). This paper shows a laboratory assay method used to detect ferritin levels in saliva. A biosensor device was developed for salivary ferritin detection. A graphene-based field-effect transistors (GFETs) functionalized with anti-ferritin antibodies through a linker molecule (1-pyrenebutanoic acid, succinimidyl ester) was used to detect ferritin (Oshin, 2020). Our project involves the use of an aptamer to detect ferritin, and an arduino based biosensor. Another paper developed ironPhone, which is a mobile-device coupled portable diagnostics for quantification of serum ferritin concentrations. This allows for iron level detection from a drop of blood from a finger prick. This iron level detection system contains a smartphone accessory, an app, and a disposable lateral flow immunoassay test strip to quantify serum ferritin (Srinivasan, 2018). Although this paper shows an iron level detection device that could be used at home, it uses serum samples instead of saliva samples.
There are a few iGEM projects we’ve found related to iron levels, but we could only find one about testing iron levels. The Judd, UK team made an optical test in 2017 that tested salivary iron levels using the relationship between iron (III) ions and amilCP (chromoprotein). While this method is definitely different from ours, it is great to see that other teams have also created devices to test salivary iron levels. We are excited to add to this effort and always on the lookout for other iGEM teams interested in this goal.
Wrap Up
Our team acknowledges that ferritin is only one marker used in assessing iron levels. Doctors generally use a more holistic assessment. Therefore, the larger goal is for the device to be expanded to test for other markers found in saliva. Our hope is that we can maximize the results found at home or outside of the lab, so that people don’t have to visit the doctor and get their blood drawn an excessive amount of times.
References
Anaemia in Women and Children (2021). World Health Organization. https://www.who.int/data/gho/data/themes/topics/anaemia_in_women_and_children
B, L. S., Rathnavelu, V., Sabesan, M., Ganesh, A., & Anandan, S. (2021). A Study to Assess the Levels of Salivary Ferritin in Iron Deficiency Anemia Subjects and Healthy Subjects. Cureus, 13(8), e17241. https://doi.org/10.7759/cureus.17241
Broyles, R. W., Belegu, V., DeWitt, C., Shah, S. N., Stewart, C. A., Pye, Q. N., & Floyd, R. A. (2001). Specific repression of β-globin promoter activity by nuclear ferritin. Proceedings of the National Academy of Sciences of the United States of America, 98(16), 9145–9150. https://doi.org/10.1073/pnas.151147098
Coffman, L. G., Parsonage, D., D'Agostino, R., Jr, Torti, F. M., & Torti, S. V. (2009). Regulatory effects of ferritin on angiogenesis. Proceedings of the National Academy of Sciences of the United States of America, 106(2), 570–575. https://doi.org/10.1073/pnas.0812010106
Colman R.W., Guo Y.L. (2005). Two faces of high-molecular-weight kininogen (HK) in angiogenesis: bradykinin turns it on and cleaved HK (HKa) turns it off. Journal of Thrombosis and Haemostasis. https://doi.org/10.1111/j.1538-7836.2005.01218.x
iGEM Team Judd. (2017). Team Judd ion iron. Team:Judd UK/description. https://2017.igem.org/Team:Judd_UK/Description
Iron-deficiency Anemia (2023). Johns Hopkins Medicine. https://www.hopkinsmedicine.org/health/conditions-and-diseases/irondeficiency-anemia
Iron-deficiency Anemia (2022). National Heart, Lung, and Blood Institute. https://www.nhlbi.nih.gov/health/anemia/iron-deficiency-anemia
Oshin, O., Kireev, D., Hlukhova, H., Idachaba, F. E., Akinwande, D., & Atayero, A. A. (2020). Graphene-Based Biosensor for Early Detection of Iron Deficiency. Sensors, 20(13), 3688. https://doi.org/10.3390/s20133688
Srinivasan, B., O’Dell, D., Finkelstein, J. L., Lee, S., Erickson, D., & Mehta, S. (2018). ironPhone: Mobile device-coupled point-of-care diagnostics for assessment of iron status by quantification of serum ferritin. Biosensors and Bioelectronics, 99, 115–121. https://doi.org/10.1016/j.bios.2017.07.038
Surguladze, N., Thompson, K. M., Beard, J. L., Connor, J. R., & Fried, M. (2004). Interactions and Reactions of Ferritin with DNA. Journal of Biological Chemistry, 279(15), 14694–14702. https://doi.org/10.1074/jbc.m313348200
Torti, S. V., & Torti, F. M. (1998). Human H-kininogen is a ferritin-binding protein. The Journal of biological chemistry, 273(22), 13630–13635. https://doi.org/10.1074/jbc.273.22.13630
Warner MJ, Kamran MT. (2022). Iron Deficiency Anemia. StatPearls Publishing. https://www.ncbi.nlm.nih.gov/books/NBK448065/