PCR amplification system used in this experiment is shown in Table 2:
Table 2 Experimental PCR amplification system
|
Reagent
|
Usage amount
|
Final concentration
|
|
PrimeSTAR Max Premix( 2 x )
|
2 5 ul
|
1x _
|
|
Primer 1
|
1 0-15 pmol
|
0.2-0.3μM _
|
|
Primer 2
|
1 0-15 pmol
|
0.2-0.3μM _
|
|
template
|
＜ 200 ng
|
|
|
Sterilized water
|
fill up to 50 µ l
|
|
PCR amplification program used in this experiment is shown in Table 3:
table 3 Experimental PCR amplification procedure
|
temperature
|
time
|
cycle
|
|
98 ℃
|
3 minutes
|
|
|
98 ℃
|
1 0 sec
|
3 0-35
|
|
55 °C
|
5 sec or 15 sec
|
|
72 °C
|
5 sec/kb
|
|
72 °C
|
5 minutes
|
|
The plasmid extraction used in this experiment was purchased from Novozyme. The specific method is as follows:
1. Take 1 - 5 ml of overnight culture (12 - 16 h) bacterial solution, add it to a centrifuge tube (prepared by
yourself), and centrifuge at 10,000 rpm (11,500 × g) for 1 min. Discard the culture medium, upside down on
absorbent paper to absorb the residual liquid. 2. Add 250 μl Buffer P1 to the centrifuge tube with the bacterial
pellet (please check whether RNase A has been added to Buffer P1 first), and mix with a pipette or vortex.
Thorough resuspension of bacteria at this step is critical to yield, and no bacterial clumps should be visible
after resuspension. If there are bacteria lumps that are not thoroughly mixed, the lysis will be affected,
resulting in low extraction volume and purity. 3. Add 250 μl Buffer P2 to step 2 , and gently invert up and down
for 8-10 times to fully lyse the bacteria. Gently invert to mix. Vortexing can cause genomic DNA fragmentation,
resulting in mixed genomic DNA fragments in the extracted plasmid. At this point the solution becomes viscous
and clear, indicating that the bacteria have been fully lysed. Do not take more than 5 minutes to avoid damage
to the plasmid. If the solution does not become clear, the lysis may be incomplete due to too many cells, and
the amount of cells should be appropriately reduced. 4. Add 350 μl Buffer P3 to step 3 , immediately invert 8 -
10 times gently to neutralize Buffer P2 completely. At this point a white flocculent precipitate should appear.
Centrifuge at 12,000 rpm (13,400 × g) for 10 min. After Buffer P3 is added, it should be inverted and mixed
immediately to prevent local precipitation from affecting the neutralization effect. If there are tiny white
precipitates in the supernatant, centrifuge again and take the supernatant. 5. Place the spin column in a 2 ml
collection tube. Carefully transfer the supernatant from step 4 to the adsorption column with a pipette, taking
care not to absorb the precipitate, and centrifuge at 12,000 rpm (13,400 × g) for 30 - 60 sec. Pour off the
waste liquid in the collection tube, and put the adsorption column back into the collection tube. 6. Add 500 μl
Buffer PW1 to the adsorption column. Centrifuge at 12000 rpm (13400 × g) for 30 - 60 sec. Discard the waste
liquid and put the adsorption column back into the collection tube. If the host bacteria are end A + (TG1, BL21,
HB101, JM series, ET12567, etc.), these host bacteria contain a large number of nucleases, which are easy to
degrade plasmid DNA, and this step is recommended. If the host bacteria are endA - host bacteria (DH5α, TOP10,
etc.), this step can be omitted. 7. Add 600 μl Buffer PW2 (please check whether it has been diluted with
absolute ethanol) to the adsorption column. Centrifuge at 12 0 00 rpm (13,400 × g) for 30 - 60 sec. Discard the
waste liquid and put the adsorption column back into the collection tube. 8. Repeat step 7. 9. Return the Spin
Column to the Collection Tube. Centrifuge at 12,000 rpm (13,400 × g) for 1 min to dry the adsorption column, in
order to completely remove the residual rinse solution in the adsorption column. Residual ethanol in the rinsing
solution will affect downstream enzyme reactions, such as enzyme digestion, enzyme chain, PCR, etc. This step
cannot be omitted. 10. Place the spin column in a new sterile 1.5 ml centrifuge tube. Add 30 - 100 μl Elution
Buffer to the center of the membrane of the column adsorption column. Let stand at room temperature for 2
minutes, then centrifuge at 12,000 rpm (13,400 × g) for 1 minute to elute the DNA. The elution volume should not
be less than 30 μl , less than 30 μl will lead to a decrease in elution efficiency. To obtain the highest yield,
preheat the Elution Buffer to 55°C to improve the elution efficiency. In addition, the solution obtained by
centrifugation can be added to the centrifugal adsorption column again, and step 10 is repeated . If the
subsequent sequencing needs to be eluted with ddH 2 O, make sure that the pH of ddH 2 O is in the range of 7.0 -
8.5, and the pH will decrease if the pH is lower than 7.0. Elution efficiency. 11. Discard the adsorption
column, and store the DNA product at -20°C to prevent DNA degradation.
Competent preparation method used in this experiment: 1. Streak on LB plates with strains stored in ultra-low
temperature refrigerators, and place them in a 37°C incubator for static culture for 12-16 hours until the
colonies grow to a diameter of 1-2mm. 2. Pick a colony with normal growth, inoculate it into 10-15mL liquid LB
medium, and culture it in a shaker at 37°C (≥250rpm) for 12-16h. 3. Take 0.5mL of the above-mentioned activated
bacterial solution and inoculate it into the prepared 50mL BTMedia , and fully shake the culture on a shaker at
37°C until the bacterial solution OD600=0.5-0.6. For 50mL culture, please use a conical tube with a capacity
greater than 250mL bottle, while the shaker speed exceeds 250rpm to ensure adequate ventilation. ¸Pay attention
to monitoring the OD value of the bacterial solution. The time required to cultivate to OD600 of 0.5~0.6 is
usually 2~3h. 4. Transfer the bacterial solution to a 50mL polypropylene plastic centrifuge tube and place it on
ice for 5-10min. ¸ Do not put the bacterial solution in the glass Erlenmeyer flask directly on ice.
The Escherichia coli transformation method used in this experiment :
1. Take out the competent E. coli from the -80°C refrigerator , and quickly insert it into the ice box to
dissolve it. 2. Add the DNA sample and mix gently, and place it on ice for 30 minutes. 3. Heat shock in a water
bath at 42°C for 45 seconds, then quickly put it back into the ice for about 2 minutes, and be careful not to
shake it. Add 700 μl of sterile medium without antibiotics and mix well. 4. Shake culture at 37°C for 1 hour
(160~225rpm), draw an appropriate volume and evenly spread it on the LB agar medium plate containing the
corresponding antibiotics. Incubate overnight at 37°C until the liquid is absorbed.
The method for transforming Clostridium tyrobutyricum in this experiment:
using a recombinant plasmid takes E. coli CA434 as the donor strain and Clostridium tyrobutyricum as the
recipient strain. The specific conjugation method is: add 30 μl / mL chloramphenicol to the strain E. coli CA434
carrying the target plasmid Cultivate in LB culture medium until the optical density (OD600 ) is 1.5 -2.0 , take
3 mL of E. coli CA434 cells, centrifuge at 4000 x g for 2 min, wash with 1 mL of 50 mM phosphate buffer saline
(PBS, pH 7.0) Wash 2 times. Then , resuspend the collected donor cells with 0.3 mL of recipient cells (OD600
2.0-3.0). Spread the cell mixture on a dry RCM agar plate and incubate in an anaerobic bag at 37°C for 20 Use
600 after h Dissolve the colony grown on the plate with mL PBS (7.0), and then re-apply on the RCM plate
containing 15 μl/ mL thiamphenicol and 250 μg /mL D-cycloserine , culture anaerobically at 37 °C , To remove
residual Escherichia coli CA434. Culture the plate for 48-96 hours until obvious colony growth is observed.
Randomly pick 10 single colonies on the plate in RCM medium containing 15 μg / ml thiamphenicol, culture
anaerobically at 37 ° C for 8-10 h, take about 1 μl for colony PCR identification, and identify After being
correct, take an appropriate amount of bacterial liquid and expand it in fresh RCM medium containing 15 μg /mL
thiamphenicol to obtain engineering bacteria .
The experimental method of nucleic acid electrophoresis in this experiment :
Weigh 0.8g agarose, dissolve in 100mL 1×TAE solution, heat in microwave until the solution is warm, shake
evenly, continue heating until the solution boils, repeat 3 times. Add 5 µL of nucleic acid dye to the
completely melted solution and shake well. Pour it into the well-arranged nucleic acid gel mold (comb and base
included), and cool it for later use.
Cell Metabolite Determination :
The metabolites acetic acid and butyric acid were detected by high-performance liquid chromatography. Take 700
µL of the bacterial solution in the culture medium and add it to a 2 mL centrifuge tube, centrifuge at 10,000
rpm for 1 min in a centrifuge, and take it out. Take the supernatant and filter it through a membrane with a
pore size of 0.22 micron into a chromatographic sample bottle, use high performance liquid chromatography (HPLC)
to measure the concentration of sugars, butyric acid and acetic acid, and use an Aminex HPX-87H organic acid
analysis column (100 mm×7.8 mm, BioRad , Marnes -la-Coquette) and maintained at 65°C with a mobile phase of 5 mM
H 2 SO 4 and a flow rate of 0.6 mL/min to determine the product. Sampling was taken after a certain period of
time and repeated several times. After obtaining the data, the cell metabolite curve was made with the sampling
time as the abscissa and the concentration converted from the peak area as the ordinate.
2.1 Construction of phosphoketolase recombinant expression plasmid derived from Bifidobacterium
adolescentis
The primers used in this experiment are listed in Table 4 :
Table 4 Primers for constructing recombinant plasmids
|
Primer name
|
Primer sequence
|
|
QS-FX-F
|
CATAAATATTTAGGAGGAATAGTCATGACGAGTCCTGTTATTGG
|
|
QS-FX-R
|
ggacgcgtgacgtcgactctagagTCACTCGTTATCGCCAGC
|
|
X- pMTL -F
|
GACTATTCTCCTAAATATTTTATGGATCC
|
|
X- pMTL -R
|
ctctagagtcgacgtcacgc
|
|
J-QS-FX-F
|
ATGACGAGTCCTGTTATTGGC
|
|
J-QS-FX-R
|
CGACGAACTCGTACGGCT
|
P thl -adhE2 constructed by B B a_ K4408008 in the database as a template, and X- pMTL -F and X- pMTL -R as
primers, the X- pthl vector ( 5461 bp) was amplified . Using the Bifidobacterium adolescentis genome as a
template and QS-FX-F and QS-FX-R as primers, a phosphoketolase ( Phosphoketolase , FXpk (QS) ) gene fragment (
2478 bp) was amplified . The FXpk (QS) gene fragment and the X- pthl linearized vector were connected by Gibson
assembly method . Carry out colony PCR (745 bp) on the transformed colonies , and the primers are J-QS-FX-F and
J-QS-FX-R . The positive colonies with correct colony PCR were transferred and the plasmid was extracted, and
the recombinant plasmid was obtained after sequencing verification : pMTL-P thl - FXpk (QS) .
figure 1 Construction of recombinant plasmid pMTL-P thl - FXpk (QS)
2.2 Construction of Recombinant Expression Plasmid of Phosphoketolase from Clostridium
acetobutylicum
The primers used in this experiment are shown in 5:
table 5 Primers for constructing recombinant plasmids
|
Primer name
|
Primer sequence
|
|
X- pMTL -F
|
GACTATTCTCCTAAATATTTTATGGATCC
|
|
X- pMTL -R
|
ctctagagtcgacgtcacgc
|
|
FXpk ( BD )-F
|
ATAAATATTTAGGAGGAATAGTCATGCAAAGTATAATAGGAAAACAT
|
|
FXpk ( BD)-R
|
cgcgtgacgtcgactctagagTTATACATGCCACTGCCAATTAG
|
|
CX-FXpk-BD-F3
|
ATGAAGCCTTTCCTTCGTATTG
|
|
CX- FXpk -R
|
gtcacgacgttgtaaaacgac
|
P thl -adhE2 constructed by B B a_ K4408008 in the database as a template, and X- pMTL -F and X- pMTL -R as
primers, the X- pthl vector ( 5461 bp) was amplified . Using the Clostridium acetobutylicum genome as a template
and FXpk (BD)-F and FXpk (BD)-R as primers, the FXpk (BD) gene fragment ( 2391 bp) was amplified . The FXpk (BD)
gene fragment and the X- pthl linearized vector were connected by Gibson assembly method . Carry out colony PCR
(1000 bp) , the primers were CX-FXpk-BD- F3 and CX- FXpk -R . The positive colonies with correct colony PCR
were transferred and the plasmid was extracted, and the recombinant plasmid was obtained after sequencing
verification : pMTL-P thl - FXpk (BD) .
figure 2 Construction of recombinant plasmid pMTL-P thl - FXpk (BD)