Safety

Safety of Experiment Personnel

All experiments are conducted in Hainan University's lab under the guidance of Yanying Hua and Yan Zhang, graduate students earning their Master's Degree under Professor Pengchen Fu’s lab.
Prior to performing laboratory research, all team members went through thorough training regarding laboratory equipment use and safety practices. All team members were asked to abide by safety guidelines provided by Hainan University.

Fig.1 Safety and Sanitation Measures of Hainan University Laboratory

Fig.2 Hainan University Experimental Guidelines for Students

Personal protective equipments such as gloves, masks, and lab coats were worn at all times when doing lab work, and the experiments were conducted in pairs, where one person performed the procedures while the other person observed, reducing potentially hazardous errors.

Fig.3 Safety Training Prior To Experimentation

Fig.4 Wearing Protective Personal Equipment

Safety of Experimental Equipment

When handling bacteria such as E. coli, equipment's such as a UV clean workbench and a biosafety cabinet are used to ensure the safety and sterilization of the surrounding environment and experimenter when working.

Fig.5 UV Clean Workbench

Fig.6 Biosafety Cabinet

Safety of Handling Bacteria

The bacteria that BS-United China will be working with is the BL21 strain of E. coli, a commonly used bacterial strain in bioengineering. The BL21 strain is non-pathogenic, meaning it is unlikely for it to cause diseases in humans or animals, and it is also a widely popular choice for producing recombinant proteins.

Measures have been taken to avoid E. coli exposure to the outside environment. Prior to experiments, workbenches are exposed to UV light before and after experiments to kill potential microorganisms by destroying their DNA and RNA material with high-energy wavelengths. Inoculation loops have been sterilized using the high temperature flames of alcohol lamps.

After completing experiments, contaminated and hazardous lab equipment is disinfected using a high-pressure steam sterilizer and rinsed. Any remaining liquid waste will be mixed with 84 disinfectant for 1-2 hours and disposed of in a liquid waste disposal container. Any remaining solid waste will be collected in a biohazard bag and handed to Hainan University to be processed and discarded.

Fig.7 High Pressure Steam Sterilizer

Fig.8 Cleaning and Rinsing Lab Equipment

Fig.9 Liquid Waste Disposal Container

Risk assessment of specific design

Q1: Estimate the possibility of Caf1-AMP E. coli (BL21) posing threat to normal E. coli.
With the experiment where we expressed Caf1-AMP in E. coli, it meant that we have created a new type of E. coli that could compete with the existing normal E. coli in the environment. Thus, the team has assessed the possibility for Caf1-AMP E. coli to pose a competitive inhibition to normal E. coli in the environment.

Due to the expression of Caf1-AMP protein inside E. coli, more energy, usually in the form of ATP, is needed to activate the function of Caf1-AMP E. coli, compared to normal E. coli in the nature. This energy constraint implies a competitive disadvantage for the newly designed bacteria and suggests that it would naturally phase out in the biological evolutionary process. Thus, it poses no threat to the E. coli in the nature.

Q2: Estimate the possibility of TurboID-SP E. coli posing threat to the environment.
In the course of utilizing TurboID-SP to reduce the quorum sensing effect of P. acnes, the enhanced functionality of the biotin implies the greater internal frictions generated which necessitate higher energy consumption in the form of ATP and biotin. However, the natural environment lacks sufficient ATP and biotin to activate the functioning of TurboID-SP. Therefore, the TurboID-SP E. coli disposed after the use of our BS Cleanser will not be activated and thus will not cause any harm to the nature.

Q3: Estimate the possibility of GPX7 E. coli posing threat to the environment.
In our design, GPX7 is used to protect our skin as its only function is to scavenge free radicals and prevent their formation that would otherwise induce tissue damage. As a result, this antioxidant enzyme will not give any competitive advantage to the engineering bacteria, E. coli (BL21), in the external environment. Consequently, GPX7 E. coli will not pose a competitive inhibition to normal E. coli.
Additionally, GPX7 E. coli is not toxic to other types of bacteria; thus, it is safe and creates no hazards when left in the environment.

Q4: Estimate the level of risk in the laboratory.
To ensure that there is no risk of experimenters bringing our engineering bacteria outside of the lab and into the external surroundings, working benches, chairs, tables, and the shoe soles are frequently wiped and cleaned once they need to enter or leave the lab. Samples collected from these places inside the lab are also regularly tested with PCR (with primer pET-21) to certify that no bacteria have bred and grown on the surfaces of the lab equipment or experimenters.

Suicide system for all engineered E. coli

Blue light suicide system

The blue light suicide system is a system that will start when our engineering bacteria lost in the external environment is not exposed to blue light. Since blue light is a type of visible light existing in the electromagnetic spectrum, its abundance in the natural environment is provided by common light sources such as sunlight, LED lights used in households, and fluorescent lights. Th team thus investigate into how the myriad of blue light in the surroundings could be used to kill the used engineering E. coli for safety purpose.

Aiming to develop this bule-light-activated suicide system, where our engineering E. coli will be killed during the absence of blue light, namely in dark or at night, we equipped our engineering bacteria with a special part to produce EL222, a llight-regulated DNA-binding protein. This protein can harness blue light to drive the reorientation of its Light-Oxygen-Voltage (LOV) sensory and Helix-Turn-Helix (HTH) effector domains, resulting in its self-dimerization and thus biding to the EL222 binding region located in between −35 (TTGACA) and −10 (TATAAT) region of the luxI promoter.

T7 promoter combining with the Ribosome Binding Site (RBS) starts the transcription and translation processes of the DNA sequence coding for EL222 protein. The protein is stored in KEGG database as ELI_04755, which the gene sequence being expressed is:
ATGTTGGATATGGGACAAGATCGGCCGATCGATGGAAGTGGGGCACCCGGGGCAGACGACACACGCGTTGAGGTGCAAC-
CGCCGGCGCAGTGGGTCCTCGACCTGATCGAGGCCAGCCCGATCGCATCGGTCGTGTCCGATCCGCGTCTCGCCGACAA-
TCCGCTGATCGCCATCAACCAGGCCTTCACCGACCTGACCGGCTATTCCGAAGAAGAATGCGTCGGCCGCAATTGCCGA-
TTCCTGGCAGGTTCCGGCACCGAGCCGTGGCTGACCGACAAGATCCGCCAAGGCGTGCGCGAGCACAAGCCGGTGCTGG-
TCGAGATCCTGAACTACAAGAAGGACGGCACGCCGTTCCGCAATGCCGTGCTCGTTGCACCGATCTACGATGACGACGA-
CGAGCTTCTCTATTTCCTCGGCAGCCAGGTCGAAGTCGACGACGACCAGCCCAACATGGGCATGGCGCGCCGCGAACGC-
GCCGCGGAAATGCTCAAGACGCTGTCGCCGCGCCAGCTCGAGGTTACGACGCTGGTGGCATCGGGCTTGCGCAACAAGG-
AAGTGGCGGCCCGGCTCGGCCTGTCGGAGAAAACCGTCAAGATGCACCGCGGGCTGGTGATGGAAAAGCTCAACCTGAA-
GACCAGCGCCGATCTGGTGCGCATTGCCGTCGAAGCCGGAATCTGA (678 nt).

With the assistance of the T7 terminator, EL222 protein can thus be successfully synthesized using the parts provided above.

As EL222 is able to homodimerize under blue light, during normal laboratory or under daytime conditions, it would induce conformational change in its LOV and HTH domains to form dimers which would later bind to the EL222 binding regions. This binding causes the release of the RNA polymerase (RNAP) sitting also in between the -35 to -10 luxI promoter region. Without RNAP, the CAS9 protein and its sgRNA cannot be expressed and used in gene editing. Consequently, the suicide system cannot complete and the ATP synthase as well as DNA polymerase of the E. coli cell continues to function, meaning that the bacteria will still survive in the external environment.

However, as nighttime approaches and blue light gradually disappears, the homodimerization of EL222 protein could not be activated and thus is unable to compete with RNAP and bind to the its binding region within the luxI promoter region. The RNAP will thus take its place and start the transcription process of CAS9 downstream, which is also assisted by the H1 promoter. CAS9 is a sizable protein weighing 160 kilodaltons, serving a crucial role in the immune defence of specific bacteria against DNA viruses and plasmids. Nowadays, it is heavily employed in genetic engineering. In our design of the suicide system, the CAS9 employed contains a unique sgRNA, a specific RNA sequence identifying the target DNA region for editing.

Two types of CAS9 proteins and their corresponding sgRNA sequences are utilized in this part of design. The CAS9 and sgRNA-A1 together collaborate to cut the ATP synthase within E. coli, rendering it nonfunctional. To pinpoint this particular sgRNA, we first identified the specific ATP synthase subunit that is crucial for the function of ATP synthase to produce ATP from ADP, labelled as P68699 on UniProt and named ATP synthase subunit C. Upon obtaining its full sequence, we utilized the sgRNA design tool at the website CRISPR direct to create the precise sgRNA sequence, GAATATGGATCTGCTGTACATTGG. Another sgRNA-A2 (sequence AAAGTCGCAATTGTATGCAC) designed by our team BS_United_China in 2022 to target the ATP synthase subunit C is also used, so that when it is combined with CAS9, two parts of the ATP synthase is destroyed, guaranteeing the death of the power house of the bacteria. The other sgRNA-R in CAS9 is designed by similar methods, except from the fact that it is used to target DNA-directed RNA polymerase subunit beta which serves as the building block of RNA polymerase in E. coli. Without the enzyme catalysing the transcription of DNA into RNA, E. coli would not be able to produce the proteins needed for its survival and would thus die. The specific sgRNA-R sequence is CGAGAAAAAACGTATTCGTAAGG. The two types of CAS9 protein targeting the parts involved in essential bacterial metabolism serve as a strong double-layered protection to the environment, as the engineering E. coli will be deactivated as soon as CAS9 is activated.

In this way, once blue light is undetectable by EL222, the formation of EL222 dimers is terminated and the RNAP is allowed to bind back to the -35 to -10 region of the luxI promoter. This thereby activates the expression of CAS9 and its sgRNA sequence (sgRNA-A1, sgRNA-A2, and sgRNA-R). The gene editing processes takes place after that, disrupting two of the most crucial parts of the bacterial cell’s metabolic pathways, energy and protein production, which eventually cause the death of bacteria.

By integrating this blue light suicide system into our engineering bacteria, precautions against potential leakage risks are established. Our engineering E. coli will not be able to survive in the external environment for more than a day, as when the night falls, it is forced to “commit suicide”. The detailed designs and procedures are illustrated in the figure below.

Fig.10 Off State occurred when blue light is absorbed by EL222. CAS9 is deactivated.
The blue light suicide system is not complete and thus the engineering E. coli lives.

Fig.11 On State occurred when it is dark and no blue light is detected by EL222. RNAP is able to bind and express CAS9 so to activate their gene editing function.
The blue light suicide system is completed and thus the engineering E. coli dies.