BS United China conducted a new sampling method to collect bacteria samples from human faces. The simplified procedures are described as: first, wash one’s face with facial cleanser; second, collect a water sample from the washing; third, filter the sample; fourth, centrifuge the sample; fifth, dilute and vortex the sample. This sampling method can effectively collect P. acne, which is confirmed by PCR results in our early experiments. There are two main advantages of this sampling method. First, the concentration and variety of bacteria in the sample are high. Since the whole face is washed, the sample water contains bacteria from every part of the face. Compared with the traditional sampling method which only takes samples from one part of the face, our new sampling method is more general and comprehensive. Second, our sampling method is safe and ethical. It is causal in the way that most people wash their face with facial cleanser every day. It is ethical in the way that the sampling method is retrospective and does not expose potential harm to experiment participants. We expect more researchers to use our sampling method because of its effectiveness, simplicity, and safety.
BS DNA-50 was designed by BS United China as a single-stranded DNA segment complementary to the 131 base pairs of the 16S rRNA gene of P. acne. The composition of the DNA has three categories: binding region (two ends), amplification region, and random region. This is the exact sequence of BS DNA-50:
5’GTGAGTGCGACTGATCCTCGTACGCGACTAGTCGACTATGGGTAATGGCA 3’.
First, the binding region was designed at the two ends of this single-stranded DNA. From background research, we discovered the PCR forward primer of 16S rRNA and designed the two ends of BS DNA-50 to be complementary to the first 22 base pairs of the gene [1]. Second, the amplification region has 20 base pairs. It is also called the common region because the amplification region is the same for other DNAs designed by BS United China. This region is responsible for the rolling circle amplification of DNA segments. Third, the random regions are randomly synthesized DNA sequences. Overall, theoretically, through ligation and rolling circle amplification (L-RCA), BS DNA-50 should have high selectivity for detecting the 16S rRNA gene of P. acne.
However, from experimental results, BS DNA-50 cannot be significantly amplified under the presence of P. acne. We attribute the failure to its short length and instability. When the length of the DNA is too short, BS DNA-50 may not effectively bind to the bacterial DNA since the DNA fragments would interact with each other. Therefore, we tried to improve the BS DNA-50 by increasing the length of the random region and designed BS DNA-162 (BS DNA 2.0)
BS DNA-162 was designed by BS United China as a double-stranded DNA segment complementary to the 131 base pairs of the 16S rRNA gene of P. acne. It has a similar composition as BS DNA-50: binding region, amplification region, and random region. The composition of the DNA has three categories: binding region (two ends), amplification region, and random region. This is the exact sequence of one strand of BS DNA-162:
5’GTGAGTGCGTCCTGTTTCTGTCTATCCAAGAATGGGCATGAGGTGGCAACCGTCGTGCTAGCGTACAGGATCCTCGTACGCGACTAGTC-
AGTCAAGGTATTTGCTCGATAATCTATACTCCAG GCATCTAACTTTTCCCACTGCCTTAAATGGGTAATGGCA3’.
Unlike BS DNA-50, which is a hypothetical prototype, BS DNA-162 was experimented with successful quality in binding the 16S rRNA gene of P. acne. Experimental results had shown the amplification result in which the DNA successfully bind to the bacteria, be ligated, and be amplified to extend beyond 162 base pairs.
Although BS DNA-162 shows the feasibility of L-RCA in detecting P. acne, it lacks stability. The electrophoresis of the amplification result do not show clear and apparent bands. Also, we suppose that when the amount of P. acne in the sample is high, more BS DNA-162 would bind the bacterial DNA and be amplified, suggesting for quantitative analysis. Therefore, we tried to further increase the length of the DNA to stabilize the result and to enable quantitative analysis. Here comes BS DNA-322 (BS DNA 3.0)
BS DNA-322 was designed by BS United China as a double-stranded DNA segment complementary to the 131 base pairs of the 16S rRNA gene of P. acne. It has the following composition: binding region, amplification region, and random region. The composition of the DNA has three categories: binding region (two ends), amplification region, and random region. This is the exact sequence of one strand of BS DNA-322:
5’GTGAGTGCGCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAACCGCGGGCTGGGAATCT-
GAGACATGAGTCAAGATATTTGCTCGGTAACGTATGCTCTAGGCATCTAACTATTCCCTGTGTCTTATATCCTCGTACGCGACTAGTC-
TGTCGAACCATAGGATTCGTGTCAGCGCGCAGGCTTGGATCGAGATGAAATCTCCGGGGCCTAAGACTACGAGCATCTGG-
CGTCTTGGCTAACCCCCCTACATGTTGTTATAAACAATCAGTGGAAACCCAGTGCTAGAGGAATGGGTAATGGCA 3’.
Similar to BS DNA-162, BS DNA-322 underwent successful experiments in determining its quality in ligation and amplification and feasibility for quantitative analysis of P. acne. The amplification results are stable and confirm with decreased amount of P. acne.
Our collaborators are very informative and interested in our researches in L-RCA. After they successfully replicated our results, they trust in our quality and creativity and ask us for novel detection or diagnosis of certain human diseases. One of the disease is called Myotonic Dystrophy which is hard to diagnose in current stage. Here is the general description. Myotonic Dystrophy has different types according to its severity which is based on the amount of repetitions of 5’ CTG 3’[2]. Myotonic Dystrophy Type 1 (DM1) is more severe and has more repetitions than Myotonic Dystrophy Type 2 (DM2). Due to the variability of the disease gene, the current method is flawed in its accuracy and time duration. However, Worm L-RCA is able to solve this issue. It has two DNA fragments working: BS Worm DNA-300 and BS Worm DNA-12. BS Worm DNA-300 is designed and is similar to previous DNAs which bind to P. acne’s DNA. It has the following composition: binding region, amplification region, and random region.
5’ CATTCCCGGCCGGAGACCAAGTAGGGCACCCTATAGTTCGAAGCAGAACTATTTCGAGGGGCGAGCCCTCATCGTCTC-
TTCTGCGGATGACTTAACACGCTAGGGACGTGGAGTCGATTCCATCGATGGTTATAAATATGAATCCAAACTAGAGCG-
GGGCTCTTGACATTTGGAGTTGTAAATATCTAATACTCCAATCGGCTTATCCTCGTACGCGACTAGTCTTACGTGCAC-
CACCGCGGGCGGCTGACGAGGGTCTCACACCGAGAAACAAGACAGTGTGATCCCCC 3’.
The binding region are at the two sides of CTG repetitions. The primers are designed based on previous studies of this target gene [3]. Unlike previous DNAs’ binding regions, the binding region, the two ends, of Worm L-RCA would not be closely held together when they bind to the target DNA. Instead, the two ends of BS Worm DNA-300 are the two ends of CTG repetitions. Within the two ends of the DNA fragments, BS Worm DNA-12 which is four triplets of 3’ GAC 5’ can bind to the repetitions of 5’ CTG 3’ in the disease gene. Next, multiples of BS Worm DNA-12 and be ligated to connect to each other and to connect BS Worm DNA-300. Finally, the circular DNA formed can be amplified and analyzed to give a prediction of the presence and severity of Myotonic Dystrophy by determining the number of repetitions of GAC. We expect this hypothetical experimental design can work successfully in accurately diagnosing Myotonic Dystrophy, contributing to this and other fields of gene detection.
Caf1-AMP was introduced by BS_United_China_2023 as a protein to capture and suppress P. acne, our identified main pathogen for acne formation. In short, Caf1-AMP, after entering the pores on human faces at a relatively warm temperature, can cool down to repolymerize into net-like structure which limit the movement of P. acne.The antimicrobial peptides attached to the protein can selectively kill the bacteria by disrupting the cell mebrane. This synthetic protein contains two parts: Capsular antigen fragment 1 (Caf1) and Antimicrobial Peptides (AMPs). Caf1 is a bacterial protein that possesses three valuable features that benefit our project. First, it is a unique protein that is thermally reformable [4]. At high temperature, long polymers of Caf1 dissociates into subunits; at low temperature, the subunits reforms into polymers without losing their function. This feature allows the protein to enter tiny pores on human faces at warm temperature and cool down into net-like structure after minutes. Second, the protein is safe for human cells, proved by previous research on its ability to encapsulate human dermal fibroblast cells while maintaining the cells’ lives [4]. Third, certain features could be added on Caf1 by attaching protein or peptides on the protein. This feature enable us to adopt AMP on the protein to effectively and selectively kill P. acne. Antimicrobial Peptides (AMPs) are small peptide molecules naturally exist for the immune system of animals [5]. In general, it adopts a broad range of mechanisms to defend the host against a variety of pathogens including bacteria. Through research, we found effective AMP that is selectively harmful for P. acne and use it in our synthetic protein. Overall, Caf1-AMP serves an important role in defend the skin from P. acne and prevent formation of acne vulgaris.
We developed the new part of TurboID-FGB based on the TurboID part design of last year’s BS_United_China 2022 [6]. TurboID-FGB is a protein ligase that binds biotin in around 10 minutes [7]. Through the binding of TurboID to a specific protein’s signal peptide that belongs to P. acne, biotinylation occurs to bind biotin onto a protein (specifically its lysine residues). Alongside streptavidin-phycoerythrin [8], we successfully inhibit the quorum sensing mechanism of bacteria. When TurboID binds to the signal peptides, FGB, of a protein, ATP and biotin are catalyzed together to produce biotinyl-5'-AMP. Using the energy from ATP, the product of biotnyl-5'-AMP can label selected proteins. The biotin bound to the protein then accumulates and effectively blocks the receptors of bacteria P. acne. Streptavidin-phycoerythrin can also join the biotin, creating an even larger barrier that blocks receptors and enabling a double-blocking system for quorum sensing. Consequently, it will be difficult for P. acne to communicate and undergo normal functions, such as virulence factor production and pathogenic behaviors [9].
Glutathione peroxidase7 (GPX 7) is a an antioxidant enzyme in mammals in response to oxidative stress [10]. Oxidative stress essentially causes the aging of skin and is typically caused by reactive oxygen species [11]. One of the reactive oxygen species that appear commonly on human face is hydrogen peroxide. However, GPX7 can catalyze the reaction to reduce hydrogen peroxide to water and prevent the oxidation and aging of skin [11],[12]. This is a way to nourish the skin in addition to the prevention of acne.
BS-United-China 2023 introduced the dark suicide system based on CAS9 utilizing the light-dependent DNA-binding protein EL222, which would start when our engineering bacteria is in a dark environment not exposed to blue light. Although the natural environment might expose abundant blue light during the day, almost no blue light exists after the sun sets or during the dark. Thus, this system can ensure that the E. coli we used to express our proteins in our project is completely killed and will do no harm to the environment.
For this system to work, we first designed a part to produce EL222 protein using T7 promoter and Ribosome Binding Site (RBS), and the corresponding DNA sequence coding for EL222 protein. As EL222 is able to homodimerize under blue light, during normal daytime conditions, it would bind to the EL222 binding region in between the −35 to −10 region of the luxI promoter [13]. This binding causes the release of the RNAP. Without RNAP, the CAS9 system downstream cannot be expressed. But if nighttime approaches, the homodimerization of EL222 protein is prevented, so RNAP can start the transcription process of CAS9. The CAS9 employed contains 3 different sgRNA sequences, two of which target the ATP synthase of the bacteria, and one targeting the RNA polymerase. In this way, it is guaranteed that the engineering bacteria is completely killed.
By using our dark (no blue light condition) suicide system, all engineered bacteria that are genetically modified for use in synthetic biology to produce proteins can be killed naturally when released into nature. The engineering bacteria will not be able to survive in the external environment for more than a day, as when the night falls, it is forced to “commit suicide”.
As included in our design, our team this year adpated the parts BBa_M45400 and BBa_R0061, which outlines the EL222 binding region and -35 to -10 region of LuxI promoter respectively. We placed the binding region inside the −35 (TTGACA) to −10 (TATAAT) region of the promoter, in order to generate a "switch" to start the CAS9 system downstream and complete our dark suicide system. The CAS9 employed contains several unique sequences of sgRNA. To enhance our CAS9 system, we adjusted our last year’s CRISPR-CAS9 system, and one of their sgRNA targeting ATP synthase subunit C was utilized in our system, which is BBa_K4329007 by BS-United-China 2022. With reference to this part, we synthesized two other sgRNA sequences, sgRNA-A2 also targeting ATP synthase and sgRNA-R targeting specifically at RNA polymerase to stop the bacteria from producing essential proteins.
Reference
[1] Nakamura, M., Kametani, I., Higaki, S., & Yamagishi, T. (2003). Identification of Propionibacterium acnes by polymerase chain reaction for amplification of 16S ribosomal RNA and lipase genes. Anaerobe, 9(1), 5–10. https://doi.org/10.1016/s1075-9964(03)00061-1.
[2] Warner, J. P., Barron, L., Goudie, D., Kelly, K., Dow, D., Fitzpatrick, D. R., & Brock, D. (1996). A general method for the detection of large CAG repeat expansions by fluorescent PCR. Journal of medical genetics, 33(12), 1022-1026
[3] Ikeda, M., Taniguchi-Ikeda, M., Kato, T., Shinkai, Y., Tanaka, S., Hagiwara, H., … Saito, F. (2020). Unexpected Mutations by CRISPR-Cas9 CTG Repeat Excision in Myotonic Dystrophy and Use of CRISPR Interference as an Alternative Approach. Molecular Therapy - Methods & Clinical Development, 18, 131–144. https://doi.org/10.1016/j.omtm.2020.05.024
[4] Dura, G., Peters, D. L., Waller, H. L., Yemm, A. I., Perkins, N. J., Ferreira, A., … Fulton, D. (2020). A Thermally Reformable Protein Polymer. 6(11), 3132–3151. https://doi.org/10.1016/j.chempr.2020.09.020
[5] Zhang, Q.-Y., Yan, Z.-B., Meng, Y.-M., Hong, X.-Y., Shao, G., Ma, J.-J., … Fu, C.-Y. (2021). Antimicrobial peptides: mechanism of action, activity and clinical potential. Military Medical Research, 8, 48. https://doi.org/10.1186/s40779-021-00343-2.
[6] “Project Description.” | BS_United_China - iGEM 2022, 2022.igem.wiki/bs-united-china/description. Accessed 3 Oct. 2023.
[7] Cho, Kelvin F., et al. “Proximity labeling in mammalian cells with turboid and split-turboid.” Nature Protocols, vol. 15, no. 12, 2 Nov. 2020, pp. 3971–3999, https://doi.org/10.1038/s41596-020-0399-0.
[8] “PE Streptavidin.” BioLegend, www.biolegend.com/ja-jp/products/pe-streptavidin-1475?GroupID=GROUP23. Accessed 4 Oct. 2023.
[9] Rutherford, Steven T, and Bonnie L Bassler. “Bacterial quorum sensing: its role in virulence and possibilities for its control.” Cold Spring Harbor perspectives in medicine vol. 2,11 a012427. 1 Nov. 2012, doi:10.1101/cshperspect.a01242
[10] GPX7 glutathione peroxidase 7 [Homo sapiens (human)] - Gene - NCBI. (n.d.). Retrieved from www.ncbi.nlm.nih.gov website: https://www.ncbi.nlm.nih.gov/gene/2882
[11] Rinnerthaler, M., Bischof, J., Streubel, M., Trost, A., & Richter, K. (2015). Oxidative Stress in Aging Human Skin. Biomolecules, 5(2), 545–589. https://doi.org/10.3390/biom5020545
[12] UniProt. (n.d.). Retrieved October 4, 2023, from www.uniprot.org website: https://www.uniprot.org/uniprotkb/Q96SL4/entry
[13] Jayaraman P., et al. “Blue light-mediated transcriptional activation and repression of gene expression in bacteria”. Nucleic Acids Research. 2016 Aug 19; 44(14):6994-7005. doi: 10.1093/nar/gkw548. Accessed 9 Oct. 2023.