Engineering Success

Abstract
Propionibacterium acnes (P. acne) is an anaerobic, Gram-positive bacterium residing in the sebaceous glands of skin, obtaining energy from fatty acids within the sebum, which can irritate the follicular wall and induce inflammation [1]. As a result, teenagers who exhibit high metabolic rates and high level of oils secretions are particularly prone to developing acne. However, after associated with skin specialists, we draw the conclusion that early prevention is better than treatment, but there are few products or methods on the market that are effective at preventing and testing acne.Thus, we have determined the orientation of our project, which is to accurately predict and prevent the occurrence of acne on face, and construct the following experiments.

List of experiments:
I.Normal PCR test for skin microbes
II.Novel L-RCA test for skin microbes
    1. BS DNA 1.0 (for detecting 5 types of microbes) BBa_K4897000
    2. BS DNA 2.0 (for detecting P. acne) BBa_K4897001
    3. BS DNA 3.0 (for detecting P. acne) BBa_K4897002
    4. Worm L-RCA 4.0 (test for Myotonic Dystrophy Type 1 (DM1)) BBa_K4897005
    5. Real time qL-RCA (for detecting P. acne)
    6. Real time qL-RCA (for detecting DMPK gene)
III.Protein purification
    1. Caf1-AMP BBa_K4897007 & BBa_K4897008
    2. His-GPX7 BBa_K4897006 & BBa_K4897008
    3. TurboID-FGB BBa_K4897008 & BBa_K4897010
IV.Antimicrobial effectiveness test
    1. Gel electrophoresis analysis
    2. Quantitative model for inhibitory capacity
V.Cytotoxicity Test
    1. Detection of cell death using BS cleanser in human cell lines
    2. Testing that BS cleanser dose no harm to E. coli by drawing E. coli growth curve

I. Normal PCR test for skin microbes

Before concentrating all our attention to againsting P. acne, we have also tested the other four types of microbes collected from the testers’ face wash, that are reported to appear on human skin in order to exam the actual causes of acne. They include:

a. Staphylococcus aureus (S. aureus)
A major bacterial human pathogen that causes a wide variety of clinical manifestations. Infections are common both in community-acquired as well as hospital-acquired settings and treatment remains challenging to manage due to the emergence of multi-drug resistant strains such as MRSA (Methicillin-Resistant Staphylococcus aureus). S. aureus is found in the environment and is also found in normal human flora, located on the skin and mucous membranes (most often the nasal area) of most healthy individuals [2].

b. Candida albicans
A yeast that naturally lives on human body. Candida albicans is a type of fungus, that is typically found in small amounts on your mouth, skin and in your intestines. Healthy bacteria in your body (microbiome) control the balance of Candida albicans. Often when Candida albicans is off-balance, the yeast overgrows and causes infection (candidiasis) [3].

c. Pseudomonas aeruginosa
A gram-negative, aerobic, non-spore forming rod that is capable of causing a variety of infections, like folliculitis, puncture wounds leading to osteomyelitis, pneumonia, otitis externa, and many others. Its predilection to cause infections among immunocompromised hosts, extreme versatility, antibiotic resistance, and a wide range of dynamic defenses makes it an extremely challenging organism to treat in modern-day medicine [4].

d. Streptococcus pyogenes
A group of spheroidal bacteria belonging to the family Streptococcaceae and is widely present in nature, on the surface of the human body, and on the inner surface of the lumen that communicates with the outside world. It is one of the most common pathogenic human purulent infections, which can directly infect and form lesions, as well as conditionally cause diseases [5].

Primers:

Materials:
1) PCR reaction: Taq enzymes
2) DNA electrophoresis: 120V run for 40 minutes with 4 μl Ethidium Bromide staining for 100 ml 1% agarose gel.

Result:

The 16S rRNA gene of P. acne is 131 base pair which correctly match with the DNA bands;
The 16S rRNA gene of S. aureus is 230 base pair which only has vague DNA bands appeared;
The 16S rRNA gene of Candida albicans is 670 base pair which appears no corresponding DNA band in gel image.

The 16S rRNA gene of Pseudomonas aeruginosa is 956 base pair which appears no corresponding DNA band in gel image; The 16S rRNA gene of Streptococcus pyogenes is 407 base pair which also appears no corresponding DNA band in gel image.

Learn:
According to the results above, we can conclude that P. acne are the bacteria that reside on human face and have a high possibility in causing acnes. Meanwhile, PCR test can be used to exam the appearance of P. acne in the sample due to its relatively clear DNA bands shown. However, in terms of S. aureus, Candida albicans, Pseudomonas aeruginosa, and Streptococcus pyogenes, the test results are vague and can not be proved of having substantial presence. This may due to the fact that 1)the presence of the latter four microbes are relatively uncommon as acne pathogenesis, 2) our testing procedures are not accurate enough, or 3) PCR testing is not specific or accurate enough to test the occurrence of S. aureus and Candida albicans.

II. Novel L-RCA test for skin microbes

We then try to use alternative method to let the primer combine with the DNA fragment with high fidelity and come out with effective and stable results. That is Ligation-Rolling Circle Amplification (L-RCA) technique. This time the primer is designed as a padlock probe which binds to the target region of bacterial DNA. Then the primer is ligated by T4-ligase and forms a single-strand circular DNA. Meanwhile, phi29 DNA polymerase is ready to amplify the circular DNA. This process would ideally extend the circular DNA which would be shown in electrophoresis.

1.BS DNA 1.0 (for detecting 5 types of microbes)

Primers:
The composition of the primer has three categories: binding region (two ends which bind with the microbes DNA templates), amplification region (or common region where forward primer and reverse primer bind to), and random region. This is the exact sequence of BS DNA-50 for 5 types of microbes:
For P. acne:
5’ GTGAGTGCGACTGATCCTCGTACGCGACTAGTCGACTATGGGTAATGGCA 3’
For S. aureus:
5’ AGCAATCATTCGTAATCCTCGTACGCGACTAGTCGGCCTACCGTCTACGA 3’
For Candida albicans:
5’ TTTAGAGGCAGCATCCTCGTACGCGACTAGTCCGCACCAGGAATAACTCT 3’
For Pseudomonas aeruginosa:
5’ TCTAGGGGGGCATCATCCTCGTACGCGACTAGTCGGACAGACTCCAGGCT 3’
For Streptococcus pyogenes:
5’ CGCCAGAAACGCTAATCCTCGTACGCGACTAGTCAGTCCTCCACCAATTC 3'

Materials:
1) L-RCA reaction: T4-ligase, phi29 DNA ligase
2) DNA electrophoresis: 120V run for 40 minutes with 4 μl Ethidium Bromide staining for 100 ml 1% agarose gel.

Result:
BS DNA-50 cannot be significantly amplified under the presence of these five types of microbes. We attribute the failure to BS DNA-50's short length and instability. When the length of the DNA is too short, BS DNA-50 may not effectively bind to the bacterial DNA since the DNA fragments would interact with each other. Therefore, we tried to improve the BS DNA-50 by increasing the length of the random region and designed BS DNA-162 (BS DNA 2.0)

2.BS DNA 2.0 (for detecting P. acne)

Primer：
BS DNA-162 was designed by BS United China as a double-stranded DNA segment complementary to the 131 base pairs of the 16S rRNA gene of P. acne. It has a similar composition as BS DNA-50: binding region, amplification region, and random region. The composition of the DNA has three categories: binding region (two ends), amplification region, and random region. This is the exact sequence of one strand of BS DNA-162:
5’GTGAGTGCGTCCTGTTTCTGTCTATCCAAGAATGGGCATGAGGTGGCAACCGTCGTGCTAGCGTACAGGATCCTCGTACGCGACTAGTC-
AGTCAAGGTATTTGCTCGATAATCTATACTCCAG GCATCTAACTTTTCCCACTGCCTTAAATGGGTAATGGCA3’.
Unlike BS DNA-50, which is a hypothetical prototype, BS DNA-162 was experimented with successful quality in binding the 16S rRNA gene of P. acne. Experimental results had shown the amplification result in which the DNA successfully bind to the bacteria, be ligated, and be amplified to extend beyond 162 base pairs.

Result and Learn:

Lane 1 is a 100 bp DNA ladder. Lane 2 is a positive control. Lanes 3-14 track the existence of P. acne from day 1 to 12 after using the BS cleanser.

Although BS DNA-162 shows the feasibility of L-RCA in detecting P. acne, the result lacks stability. The electrophoresis of the amplification result does not show clear and apparent bands. Also, we suppose that when the amount of P. acne in the sample is high, more BS DNA-162 would bind the bacterial DNA and be amplified, suggesting for quantitative analysis. Therefore, we tried to further increase the length of the DNA to stabilize the result and to enable quantitative analysis. Here comes BS DNA-322 (BS DNA 3.0)

3.BS DNA 3.0 (for detecting P. acne)

Primer:
BS DNA-322 was designed by BS United China as a double-stranded DNA segment complementary to the 131 base pairs of the 16S rRNA gene of P. acne. It has the following composition: binding region, amplification region, and random region. The composition of the DNA has three categories: binding region (two ends), amplification region, and random region. This is the exact sequence of one strand of BS DNA-322:
5’GTGAGTGCGCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAACCGCGGGCTGGGAATC-
TGAGACATGAGTCAAGATATTTGCTCGGTAACGTATGCTCTAGGCATCTAACTATTCCCTGTGTCTTATATCCTCGTACGCGACTAGTC-
TGTCGAACCATAGGATTCGTGTCAGCGCGCAGGCTTGGATCGAGATGAAATCTCCGGGGCCTAAGACTACGAGCATCTGGC-
GTCTTGGCTAACCCCCCTACATGTTGTTATAAACAATCAGTGGAAACCCAGTGCTAGAGGAATGGGTAATGGCA 3’.

Result:

Lane M: DNA Ladder. Lane 1: Only the BS DNA-322 is used. Lane 2: One off-target DNA and BS DNA-322. Lane 3: Only the BS DNA-322 is used. Lane 4: Four off-target DNAs and BS DNA-322. Lane 5: Bacterial DNA acquired from person 1 tested by BS DNA-322 only. Lane 5: Bacterial DNA acquired from person 2 tested by BS DNA-322 only. Lane 7: No DNA fragment tested. Lane 8: No primers added. Lane 9: No primers added

Similar to BS DNA-162, BS DNA-322 underwent successful experiments in determining its quality in ligation and amplification and feasibility for quantitative analysis of P. acne. The amplification results are stable and confirmed with decreased amount of P. acne.

4.Worm L-RCA 4.0 (test for Myotonic Dystrophy Type 1 (DM1)

Our collaborators are very informative and interested in our researches in L-RCA. After they successfully replicated our results, they trust in our quality and creativity and ask us for novel detection or diagnosis of certain human diseases. One of the diseases is called Myotonic Dystrophy which is hard to diagnose in current stage. Here is the general description. Myotonic Dystrophy has different types according to its severity which is based on the amount of repetitions of 5’ CTG 3’ [2]. Myotonic Dystrophy Type 1 (DM1) is more severe and has more repetitions than Myotonic Dystrophy Type 2 (DM2). Due to the variability of the disease gene, the current method is flawed in its accuracy and time duration. However, Worm L-RCA is able to solve this issue. It has two DNA fragments working: BS Worm DNA-300 and BS Worm DNA-12. BS Worm DNA-300 is designed and is similar to previous DNAs which bind to P. acne’s DNA. It has the following composition: binding region, amplification region, and random region.
5’CATTCCCGGCCGGAGACCAAGTAGGGCACCCTATAGTTCGAAGCAGAACTATTTCGAGGGGCGAGCCCTCATCGTCTCTT-
CTGCGGATGACTTAACACGCTAGGGACGTGGAGTCGATTCCATCGATGGTTATAAATATGAATCCAAACTAGAGCGGGGC-
TCTTGACATTTGGAGTTGTAAATATCTAATACTCCAATCGGCTTATCCTCGTACGCGACTAGTCTTACGTGCACCACCGC-
GGGCGGCTGACGAGGGTCTCACACCGAGAAACAAGACAGTGTGATCCCCC 3’.
The binding region are at the two sides of CTG repetitions. The primers are designed based on previous studies of this target gene [3]. Unlike previous DNAs’ binding regions, the binding region, the two ends, of Worm L-RCA would not be closely held together when they bind to the target DNA. Instead, the two ends of BS Worm DNA-300 are the two ends of CTG repetitions. Within the two ends of the DNA fragments, BS Worm DNA-12 which is four triplets of 3’ GAC 5’ can bind to the repetitions of 5’ CTG 3’ in the disease gene. Next, multiples of BS Worm DNA-12 and be ligated to connect to each other and to connect BS Worm DNA-300. Finally, the circular DNA formed can be amplified and analyzed to give a prediction of the presence and severity of Myotonic Dystrophy by determining the number of repetitions of GAC. We expect this hypothetical experimental design can work successfully in accurately diagnosing Myotonic Dystrophy, contributing to this and other fields of gene detection.

5.Real time qL-RCA (for detecting P. acne)

Although the L-RCA technique has already helped us save a lot of time in detecting P. acne, the process of results analyzing by the use of gel electrophoresis is time consuming, and the gel image we get can only provide us with semi-quantitative test result. Thus, we apply fluorescence-quantitative detection in our project instead of gel electrophoresis to further reduce the time consume and quantify our results.

Hypothesis:
1) At first, the concentration of bacteria DNA template is low. Therefore, the fluorescence intensity is too low to be detected and only the background signal is evident.

2) During the process of DNA amplification, double-stranded DNA formed and SYBR Green can bind with the hydrogen bond between the double-stranded DNA and fluoresce. The intensity of the fluorescence above the background level is then be measured and used to quantitative the amount of newly generated double-stranded DNA.

3) With more amplified DNA and higher base pair length through rolling circle amplification, there will be more double-stranded DNA that SYBR Green can bind to. Subsequently, we can distinguish people with higher P. acne level to people with lower P. acne level.

Materials:
1) SYBR Green Nucleic Acid Gel Stains (SYBR Green I)
2) L-RCA test kit and standard synthesized 16s rRNA of P. acne

Procedures:
1) Construct five isolated experiments with different DNA templates. There are synthesized 16s rRNA of P. acne, DNA derived from the face wash sample of student 1, DNA derived from the face wash sample of student 2, DNA derived from the face wash sample of student 3 and fragments of random DNA.
2) Follow the same protocol as L-RCA
3) Add 0.2 µL SYBR Green I per single 20 µL reaction to the mix.
4) Detect the SYBR signal and record the data through the fluorometer.

Result and analysis:
(Data and graph)
1) Independent variable: SYBR signal / RFU (10^3)
Dependent variable: time period / 20 s

2) As the graph shown above, the P. acne DNA amplification cycle threshold (CT) value is 17×20 second (340 s) which suggests a standard value for the comparison of the initial amount of the P. acne DNA in the test sample. Besides, the CT value is inversely proportional to the amount of DNA sample which means that the lower the CT value, the higher the amount of DNA sample it contains. Meanwhile, we set up a standard that CT value below 30×20 second is at high acne vulgaris risk while any value above it is considered as at low acne vulgaris risk. Based on these knowledge, the CT value of the sample of student 2 (shown by the yellow dots) is 23×20 second (460 s), followed by 26×20 second (520 s) of the sample of student 3 (shown by the light blue dots). By contrast, the CT value 30×20 second (600 s) owned by the sample of student 1 (shown by the grey dots) which is high enough to be diagnosed as at low acne risk. At last, no CT value shown on the random DNA (orange dots) indicates the success of our experiment. In conclusion, real time qL-RCA successfully breaks new ground for us to qualify our test results and make up for our limitation in consuming long time in gel electrophoresis

6.Real time qL-RCA (for detecting DMPK gene)

At the same time, we also advance our result analyzing technique for the detection of DMPK gene (the culprit gene of myotonic dystrophy type 1) by artificially synthesizing the gene and conduct the design experiment. In this way, we can provide an even quicker method to the test of DM1 which would better meet the needs of medical industry.

Materials:
1) SYBR Green Nucleic Acid Gel Stains (SYBR Green I)
2) L-RCA test kit and mimic DMPK gene

Procedures:
1) Construct three isolated experiments with different DNA templates. There are mimic DMPK gene, mimic DMPK gene again and fragments of random DNA.
2) Follow the same protocol as L-RCA
3) Add 0.2 µL SYBR Green I per single 20 µL reaction to the mix.
4) Detect the SYBR signal and record the data through the fluorometer.

Result and analysis:
(Data and graph)
1) Independent variable: SYBR signal / RFU (10^3)
Dependent variable: time period / 20 s

2) Firstly, two repeat tests mimic DM1 DNA both have CT values, and the random DNA shows no CT value initially prove the feasibility of our design test. Second, two repeat tests share a consistent CT value (around 30×20 second) meaning the accuracy and repeatability of our experiment. In conclusion, our real time qL-RCA is proven that it not only can detect the double-stranded DNA of P. acne, but also it is a generic method of combining thermostatic rolling cycle amplification to the fluorescent dyes.

III. Protein purification

Comparing to the existence treatment of acne vulgaris on the market, which is dominated by the chemical or physical means, ranging from coating salicylic acid to laser therapy, our biological way in dealing with P. acne is safer and better targeted.

Materials:
1) LB medium
2) A monoclonal antibody that binds to the His tag recombinant protein
3) IPTG
4) Lysozyme
5) BeyoGold™ His-tag Purification Resin
6) Non denatured detergent
7) Nondenature Lysis Buffer
8) Non denatured eluent
9) Empty Column Tube for Affinity Chromatography, 3ml

Procedures:
1) Induction expression of soluble His-tagged recombinant protein in E. coli
a) Take a single clone expressing the His-tagged recombinant protein and inoculate it into 10ml LB medium, adding 0.01ml AMP (ratio of AMP to LB medium is 1:1000), containing appropriate antibiotics and culture overnight.
b) Take 2.5ml of the overnight culture and inoculate it into 5000ml pre-warmed LB medium at 37ºC.
c) Cultivate at 37ºC for about 30-60 min or longer until the OD600 of the culture reaches 0.5-0.7.
d) Add IPTG to a final concentration of 1 mM and culture for another 4-5 hours.
e) Collect the culture to a centrifuge tube and centrifuge at 4ºC and 4,000g for 20 min. Discard the supernatant and collect the pellet.

2) Large-scale purification of His tag protein under denaturing conditions
a) Add 4 ml of non-denaturing lysis solution to each gram of bacterial precipitate at a ratio of 1:4, and fully suspend the bacteria.
b) Add lysozyme to a final concentration of 1 mg/ml and mix well. Incubate on ice for 30 minutes.
c) Ultrasonically lysate the bacteria on ice. The ultrasonic power is 200-300 W, and each ultrasound treatment lasts for 10 seconds, with a 10-second interval between each treatment. A total of 6 ultrasound treatments are performed.
d) Centrifuge at 4ºC and 10,000g for 20-30 minutes to collect the supernatant of the bacterial lysate and place it in an ice bath or on ice.
e) Take 1 ml of the mixed 50% BeyoGold™ His-tag Purification Resin (nitrilotriacetic acid chelating resin) and centrifuge at 4ºC to discard the storage solution. Add 0.5 ml of non-denaturing lysis solution to the gel and mix well to balance the gel. Centrifuge at 4ºC to discard the liquid, and repeat the balancing process 1-2 times. Discard the liquid. Add about 4 ml of the bacterial lysate supernatant to the gel and place it in the refrigerator at 4ºC. Shake it every five minutes for an hour.
f) Put the lysis solution and the mixture of BeyoGold™ His-tag Purification Resin (nitrilotriacetic acid chelating resin) into the empty column tube provided in the kit for affinity chromatography.
g) Open the lid at the bottom of the purification column and let the liquid flow out under gravity.
h) Wash the column 5 times with 0.5-1 ml of non-denaturing washing solution.
i) Elute the target protein 6-10 times with 0.5 ml of non-denaturing elution solution.
j) Collect each elution solution in a different centrifuge tube. The collected elution solution is the purified His-tag protein sample.

Results：
1) Caf1-AMP

According to the Western Blotting method, Lane M is the marker, and the following five lanes indicated purified Caf1-AMP monomer. The actual mass of Caf1-AMP is 15kDa, and the reason why there are several other protein bands appear is due to the nature of the Caf1 protein, which is a thermally reformable protein, and at low temperatures, the subunits reformed into polymers without losing their function. Also, high molecular weight Caf1-AMP appeared at 30 Celsius degrees as the graph shows.

2) His-GPX7

Using Westen blotting, a technique that can help us to identify the specific protein based on the size of the protein, we can then tell whether His-GPX7 is purified and whether the purified protein is our His-GPX7 or not. From the graph above, Lane M is the marker, and Lane 1 is the purified GPX7 from E. coli BL21. His GPX7 indeed has a weight of around 21kDa.

3) TurboID-FGB (+ Effectiveness of Biotinylation)

We can notice that TurboID-FGB can successfully label activated biotin onto P. acne, as the red Streptavidin-568 can strongly bind to activated biotin and colors the P. acne which is labeled with abundant biotin. This shows effective purification for TurboID-FGB to function.

IV. Antimicrobial effectiveness test

After successfully purifying the protein (BS cleanser), we then began to perform protein efficacy testing. Basically, we attach face mask deriving from the tester’s face to solid beef extract peptone agar to mimic a human facial environment in vitro. Next, we spray BS cleanser onto the agar plate evenly and test for the results through the gel electrophoresis. The following are the detailed procedures:

1. Gel electrophoresis analysis (BS Cleanser Inhibition of P. acne Deriving from Face tracked Through L-RCA over 12-Day Period)

Rationale:
1) Through the BS L-RCA test kit, we have realized that there are certain people who have a higher abundance of P. acne and are therefore at a higher risk of acne vulgaris.
2) We want to testify the effect of BS cleanser on reducing the risk of people getting acne.

Hypothesis:
1) Circular DNA of people with lower risk and lack of P. acne cannot be guided to ligate into circular DNA, causing the DNA product to retain the original base pair (bp) length.

2) Circular DNA of people with higher risk and abundance of P. acne will be guided for ligation into circular DNA by P. acne DNA, which gets extended by phi29 DNA polymerase.

3) People with higher risk and more P. acne produce DNA fragments of higher bp length as the abundance of P. acne DNA can facilitate more productive ligation and amplification of DNA.

Procedures:
1) Mimic human face with P. acne to collect for L-RCA

a) Hydrate facial mask paper and place on face (subject is tested right after coming home at ~5pm, did skin care the night before) for 20 minutes for absorption of bacteria

b) Prepare 7 petri dishes with solid beef extract peptone agar

c) Cut the facial mask paper into 7 equal pieces and place each flat onto each of the petri dishes
i. Incubate at room temperature of laboratory, leave opening in petri dish for oxygen flow

d) Spray face mask with BS cleanser every day

2) Obtain Bacterial DNA for each day from day 1-7:

a) Take one petri dish and utilize 100ml of double distilled water to wash the material off the face mask into a small beaker after 30 minutes after BS cleanser is sprayed

b) Filter the solution to obtain bacteria
ii. Using filter paper, filtrate the solution 3 times.
iii. Centrifuge solutions at 12000rpm for 10 minutes in centrifuge machine
iv. Pour liquid out of centrifuge tube, invert tube and place filter paper at the bottom to fully remove any liquid portion
v. Pour 15ml of Milli-Q water on tube wall to remove bacteria from wall
vi. Vortex the tube to mix thoroughly

c) Lyse bacteria to obtain DNA
i. Inject bacterial solution into PCR tubes
ii. Place into PCR machine for 5 minutes under 95°C

3) Undergo L-RCA

a) Explanation: The BS DNA-162 that we prepared to be ligated into circular DNA under the guidance of P. acne bacterial DNA is the following: (composed of the complementary DNA with P. acne template, common region that is binded to for extension around DNA, and random DNA segments)

b) DNA fragment:
5’GTGAGTGCGTCCTGTTTCTGTCTATCCAAGAATGGGCATGAGGTGGCAACCGTCGTGCTAGCGTACAGG-
ATCCTCGTACGCGACTAGTCAGTCAAGGTATTTGCTCGATAATCTATACTCCAGGCATCTAACTTTTCCCACTGCCTTAA-
ATGGGTAATGGCA 3’

c) Prepare reaction mixture under the following condition:

d) Incubate at 30°C for 10 minutes

4) Undergo gel electrophoresis

a) Prepare 1% agarose gel 4μl of Ethidium Bromide
b) Add the reaction mixtures
c) Run electrophoresis machine for 40 minutes under the voltage of 120V
d) Obtain image using UV machine

Results:
1) BS cleanser is found to effectively inhibit P. acne and decrease DNA abundance of the bacteria, as seen in the gel electrophoresis image below.

Lane 1 is a 100 bp DNA ladder. Lane 2 is a positive control. Lanes 3-14 track the existence of P. acne from day 1 to 12 after using the BS cleanser.

In this gel electrophoresis image, there exist clear DNA fragments at ~162bp, which is the size of the circular DNA primer. This shows the primer’s inefficiencies in properly ligating into circular DNA by T4 DNA ligase, as the linear DNA without proper ligation would be of that base pair length.

It can be seen that the earlier lanes of electrophoresis like lanes 3, 4, 5, and 6 are much darker. There are clear dark regions at ~550 bp and ~483 bp. As the BS cleanser is used for more days, less DNA fragments are identified overall through electrophoresis, especially those of higher bp that are obtained by continuous extension of the ligated circular primers. DNA fragments are around ~483 bp and ~322 bp alongside the 162 bp circular DNA primer. Lanes 13 and 14 are clearly the lightest, showing the strong performance of the BS cleanser.

From the rate of change of the lambda value, it is seen that the BS cleanser can decrease 7.806% of P. acne every day. Figure 12 shows that the BS cleanser turns the sample into a low-risk state after 7 days of utilizing the product (51.768%).

2.Quantitative model for inhibitory capacity (Quality Control of a Novel Detection Technique, L-RCA)

Rationale:
1) PCR amplification to detect P. acne is already commercialized in test kits, and the results are successfully replicated by B.S. United China. However, PCR detection often comes with lower specificity and long waiting hours. Therefore, a new detection technique is needed.

2) L-RCA, when designed and modified by B.S. United China, can a quick detection technique within minutes with high specificity to detect P. acne bacterial DNA [1].

3) Preparing for putting L-RCA into use, B.S. United China has to determine the effectiveness of L-RCA especially under distractions when other amplification primers are put into use.

4) In order to conduct quality control of L-RCA ability, two kinds of DNA sequence that serves like primers in PCR are investigated. First, on-target DNA is a DNA sequence complementary to P. acne’s DNA). Second, off-target DNA is a randomly generated DNA sequence of 322 base pairs which might distract the binding process of on-target DNA to P. acne’s DNA. Next, it is necessary to investigate the quality of L-RCA results with and without on-target and off-target DNA.

Hypothesis:
1) BS DNA-322 is a DNA sequence designed by B.S. United China to detect P. acne. At each end of this single stranded DNA, it has complementary sequences (in red) which can be bound to the bacterial DNA. Therefore, it is an on-target DNA. Then, the ends can be successfully ligated into a single stranded circular DNA under the guidance of P. acne and amplified by phi29 DNA polymerase to extend beyond 322 base pairs. Therefore, result showed by electrophoresis should be beyond 322 base pairs.

2) When many off-target DNAs are present and compete with BS DNA-322, BS DNA-322 cannot be easily bound to P. acne's DNA. Then, BS DNA-322’s two ends are not close enough without the guidance of the bacterial DNA and cannot be ligated. Therefore, the size of BS DNA-322 still remains at 322 base pairs even after amplification.

Procedures:
1) Obtain Bacterial DNA from human face by washing

a) One experiment participant washes his face with facial cleanser and pure water. And the solution of the water from washing is collected.

b) Filter the solution to obtain bacteria
i. Using filter paper, filtrate the solution 3 times.
ii. Centrifuge solutions at 12000rpm for 10 minutes in centrifuge machine
iii.Pour liquid out of centrifuge tube, invert tube and place filter paper at the bottom to fully remove any liquid portion
iv. Pour 15ml of Milli-Q water on tube wall to remove bacteria from wall
v. Vortex the tube to mix thoroughly

c) Lyse bacteria to obtain DNA
i. Inject bacterial solution into PCR tubes
ii. Place into PCR machine for 5 minutes under 95°C

2) Undergo L-RCA

a) Explanation:The BS DNA-322 that we prepared to be ligated into circular DNA under the guidance of P. acne bacterial DNA is the following: (composed of the complementary DNA with P. acne template, common region that is binded to for extension around DNA, and random DNA segments). The complementary DNA sequence, adjusted for direction, is designed based on existing research [2].
b) DNA fragment: 5’
GTGAGTGCGCTCCTCGTCAGCAGTCTGGTGTATCGAAAGTACAGGACTAGCCTTCCTAGCAACCGCGGGCTGGGAATC-
TGAGACATGAGTCAAGATATTTGCTCGGTAACGTATGCTCTAGGCATCTAACTATTCCCTGTGTCTTATATGGGTAATGGCA-
TGTCGAACCATAGGATTCGTGTCAGCGCGCAGGCTTGGATCGAGATGAAATCTCCGGGGCCTAAGACTACGAGCATCTGG-
CGTCTTGGCTAACCCCCCTACATGTTGTTATAAACAATCAGTGGAAACCCAGTGCTAGAGGAATGGGTAATGGCA 3’
c) Other information: Other non-specific DNA templates are randomly generated DNA sequences all with 322 base pair which is supposed to compete with BS DNA-322.
d) Prepare reaction mixture under the following condition [3], [4]:

e) Incubate at 30°C for 10 minutes

3) Undergo gel electrophoresis

a) Prepare 1% agarose gel 4μl of Ethidium Bromide
b) Add the reaction mixtures
c) Run electrophoresis machine for 40 minutes under the voltage of 120V
d) Obtain image using UV machine

Results:
1) BS DNA-322 can successfully bind to bacterial DNA of P. acne without competition of other off-target DNAs.
2) As competition between the DNAs binding to the bacterial DNA, the success rate of BS DNA-322 is only slightly reduced.

Lane M: DNA Ladder. Lane 1: Only the BS DNA-322 is used. Lane 2: One off-target DNA and BS DNA-322. Lane 3: Only the BS DNA-322 is used. Lane 4: Four off-target DNAs and BS DNA-322. Lane 5: Bacterial DNA acquired from person 1 tested by BS DNA-322 only. Lane 5: Bacterial DNA acquired from person 2 tested by BS DNA-322 only. Lane 7: No DNA fragment tested. Lane 8: No primers added. Lane 9: No primers added

The primers before binding to bacterial DNA are 322 bp in size. If the intensity of the band at 322 base pairs is weak, it means theoretically the DNAs are bound to the bacterial DNA, ligated, and amplified. The amplification of the DNAs extends the circular DNA fragment, and the circle coils upward from the plane of the circle. Therefore, amplified DNA fragments end up in regions of large bp sizes regarding the ladder.

Lane 1 is only tested with BS DNA-322. It shows a positive result in which all BS DNA-322 bond to the bacterial DNA, ligated by T4 Ligase, and amplified by phi29 polymerase. Thus, no band is shown at 322 bp. Similarly, Lane 3 shows a complete ligation and amplification of BS DNA-322.

Lane 2 is tested with BS DNA-322 and one off-target DNA. It shows three prominent bands at roughly 322 bp, 500 bp, and 600 bp, suggesting that some primers are successfully amplified while some are left. We can infer that the non-specific DNA template, as we supposed, did not bind to the bacterial DNA and remained its original size. It contrasts with results in Lane 1 and 3 in which all the specific primers are successfully amplified. Furthermore, it validates that BS DNA-322 still works under the competition with one type of off-target template. Likewise, Lane 4 shows a similar result as Lane 2. The difference between Lane 2 and Lane 4 is that Lane 4 contains four off-target DNAs and BS DNA-322. The prominent bands of Lane 4 at roughly 500 and 600 base pairs suggest that BS DNA-322 still works under competition. Lane 5 and Lane 6 are tested with BS DNA-322 only. It shows bands at roughly 322 base pairs, 500 base pairs, and bigger sizes weakly. As we postulate, only some primers are successfully amplified. The reason why not all BS DNA-322 are amplified may be explained by the concentration of bacterial DNA fragments. Only Lane 5 and Land 6 test the bacterial DNA sampled from human skin, and all other lanes test the concentrated, synthetic DNA fragments of P. acne.

Conclusion and Discussion
1) BS DNA-322 can successfully bind to the bacterial DNA of P. acne. The signal can be amplified by ligation and RCA. Then, it can very easy to see from the agarose gel, which suggest the feasibility of using fluorescence such as SYBR dyes or Taqman probe. Thus, real time detection technique could be achieved by incorporating L-RCA technique, saving much time in detection of DNA products.

2) Once the quality of L-RCA to detect P. acne is guaranteed, quantification of the amplification result might be achieved to quantify the concentration of bacterial DNA.

3) If BS DNA-322 can detect the bacterial DNA of P. acne, it can also be applied in detecting human DNA from patients suffering from genetic diseases by altering the sequence of complementary DNA in BS DNA-322. For example, DNA sequences with repeating units by a variable number could not be detected by PCR due to the variability of the target sequence. However, using L-RCA, repeating units of DNA fragments which are complementary to the repeating units of human DNA can be ligated to secure a long circular DNA. Therefore, by amplifying this signal, we can diagnose the idea and even its severity.

4) From the collaboration with Doctor Haitao Zhou, we expect our L-RCA and worm RCA can apply for SCI.

V.Cytotoxicity Tests

1. Detection of cell death after using BS cleanser in human cell lines

Turbo ID and Caf1-AMP being proteins that would be applied to our skin, the question of whether the substance harm the skin cell is thus a problem that need to be addressed. By applying both proteins onto 293t human embryonic Kidney cell to simulate the application of both substance effect on the amount of cell death via flow cytometry, we can find out whether the protein is harmful to human skin cell.

Procedures:
Cultivating of 293t human embryonic kidney cells:

1) Apply the 293t sample to a thermostat water bath at 37°C.
2) After the 294t cell sample has fully unfrozen, use a pipette to apply the sample into a 1.5ml sterile or other sterile centrifugal tube that is suitable.
3) Apply the centrifugal tube into the centrifuge with an identical sample on both sides, And centrifuge it for 2~5 minutes.
4) Using a pipette, aspirate the supernatant without removing the 293t cell pellet.
5) Resuspend the 293t cell pellet into a new culture medium and transfer the medium into a CO₂ culture vessel at 37°C.
6) Change the culture medium accordingly the next day, depending on the adhesion growth status.
7) Apply the culture sample along with PBS to the thermostat water bath at 37°C to preheat.
8) Using a pipette, aspirate the culture medium into the old medium.
9) Apply 3~5 mL of PBS to rinse the old medium sample 1~2 times, thus removing the residual serum.
10) Add 3 mL of proteolytic enzyme trypsin to the culture medium.
11) Set aside for 3~5 minutes, and examine the change every 30~60 seconds using a microscope, till the adherent cell shrinks, the gaps between cells increase, and the 293t cell tends to become round but not floating.
12) remove the trypsin via aspiration.
13) Apply 1~2 mL of fresh culture medium to the sample and shake the cell dish to stop trypsin activity.
14) pipette the adherent cell to obtain cell suspension.
15) Transfer the cell suspension into 3~6 culture dishes and apply fresh culture medium.
16) Place the 3~6 culture dish sample into a CO₂ culture vessel at 37°C.
17) The next day, observe the adhesion growth, change accordingly to the color change, and change the medium regularly according to the medium-changing requirements of the 293t cell. If the cell density reaches 80 ~ 90%, the sample needs to be frozen or passaged.
18) Apply Lipopolysaccharide (LPS, mimic bacterial infection), TurboID-FGB, Caf1-AMP to culture disk separately and label test cases.

Detection via flow cytometry:

1) Apply 10uM Propidium iodide, incubate at room temperature for 15 minutes
2) Test on the flow cytometry machine.
3) Measure the emitted light of propidium iodide afterwards.

Method:
Flow cytometry is a technique used to identify the properties of a cell. It can be used as a sorting technique or analysis technique. In BS united case of Caf1-AMP and turbo ID’s application, flow cytometry is an analysis technique used to allocate the 293t cell’s changes from healthy to cell death. The flow cytometry is composed of 3 main parts, Front-scattered light (FSC), side-scattered light (SSC) and a flow cell or sample. The FSC will show the diameter of the flow cell, and SSC will show the complex, of which can show the number and data of the organelles of the flow cell.

In this process, we use propidium iodide (PI), a fluorescent that is bound to DNA and emits red light. It’s a dead cell stain and is used widely in detection of cell death due to it properties of binding to the genetic information(DNA & RNA). Under flow cytometry, the propidium iodide staining helps us detect the dead cells, as dead cell unlike healthy cell does not consist of a intact membrane and thus we can detect PI because it properties of not being permeable, thus separating the dead cells and healthy cells.

In the right table of our results, the x-axis (PE-A) represents the fluorescent intensity which is a channel that emit light and excite the Propidium iodide that’s bound to the DNA of the dead cell. After exciting the propidium iodide, the fluorescent properties will then emit light that can detected and measured.

Experiment Analysis:
The graph consists of duplicates, two cells within one droplet, and also the FSC, SSC, and the PE channel to test the fluorescent intensity of the cells. It can, as above, tell us about the length in diameter, the complexity, and also the luminosity intensity of the dead 293t human embryonic cells. In the diagrams below, all samples have lipopolysaccharide application which mimics the bacterial infection. The procedure of treatment of all cells is that they are pre-treated with LPS and then followed by treatment with A drug (Caf1-AMP) and C drug (GPX7).
1) Control group – only 293t human embryonic cell

The control group contains human embryonic kidney cells, with additional Propidium iodide for dead cell staining and the application of Lipopolysaccharide to mimic bacterial infection. As the gate in diagram on the left only contains 81.40% of the entire specimen, which is consist of both dead and live cell, the diameter of the 293t cells that is visible via FSC (front scatter light) are allocated between the diameter of 16.375 in length to 147.475. The side scatter light on the x-axis indicates a high density of 293t cell between the gate level of 0.0 to 131.1, thus leading to a relationship between the length and its granularity of the 293t cells that is shown to be a positive connection.

Via detecting the propidium iodide on the right diagram we can see two gates, in green the healthy living cell (gate 4) and in pink the dead cell (gate 5). As the channels emit light that excite the propidium iodide which is a fluorescent dye which will bound to the DNA of dead 293t cells, we can examine the amount of the dead cell via the light emitted by the propidium iodide after excitation, in this way looking at the fluorescent intensity we find that the percentage of dead 293t cells in the culture medium caused by bacterial infection is about 18.48% and because the propidium iodide does not have membrane permeability, it won't be able to bind to the DNA of living cell as living cell consist a well intact membrane, thus the fluorescent intensity is low for dead cells and via this way we can separate the living and the dead cell.

2) 293t human embryonic cell with Caf1-AMP

Caf1-AMP in our product is used for killing P. acne. The simulation of applying the protein on 293t human embryonic cell with Lipopolysaccharide to mimic the bacterial infection can be used to simulate whether it will harm the skin cell which is not our target.

In this diagram, we get to see the change after the applying of Caf1-AMP to the 293t cells with PI compared to the control group with 293t cells and propidium iodide, the droplet sample shows a higher and pact density when looked at the side and front scatter light, and a better result in the fluorescent intensity test. As in the diagram on the right, presented in gate 5, the dead cell percentage decreases to 10.08%, and an increase in percentage of living cell in gate 4 can be a result of the existence of Caf1-AMP effects to Lipopolysaccharide. As Caf1-AMP plays the role of killing bacteria, the Lipopolysaccharide bacterial population may decrease and result in a lower amount of cell deaths.

To summarize, the application of Caf1-AMP will not affect the percentage of dead 293t cells, as the fluorescent intensity test shows a better result. Caf1-AMP won't cause cell death in 293t stimulating skin cells.

3) 293t cells with GPX7

GPX7 in our product is used to decrease oxidative stress as it can nurture cells and remove hydrogen peroxide which is a chemical that will increase apoptosis and aging.

Examining the two diagrams, the samples have a few slight changes, but overall, they haven’t changed a lot compared to the sample with Caf1-AMP. Since hydrogen peroxide induces cell aging and apoptosis, the removal of hydrogen peroxide by GPX7, which is an anti-oxidative stress reagent, decreases the amount of dead 293t cell examined compared to the sample that consist only of 293t cell infected by Lipopolysaccharide.

4) Conclusion In conclusion, the two samples that consist of Caf1-AMP & GPX7 examine a decrease in cell death percentage. The decrease in percentage is examined by an observable change in fluorescent intensity change in the dead cell compared with the living cell droplets, and it is caused by the application of Caf1-AMP and GPX7 that lowers the damage caused by Lipopolysaccharide when compared back to the original sample without Caf1-AMP and GPX7.

2. Testing that BS cleanser dose no harm to E. coli by drawing E. coli growth curve

One of the key premises that we need to ensure is that the adding of our synthetic plasmid will not cause damage to our engineering bacteria, the E. coli, in order to reach a constant and stable output. Therefore, we incubate the E. coli and construct its growth curve, and then compare it with the growth curve after we insert our plasmid into it to see whether our synthetic plasmid would disturb the growth state of the E. coli or not. The followings are the E. coli growth curves.

Methods:
1) Bacterial activation, thawing and constant temperature shaking
2) Bacterial sampling, using double-distilled water as a control, measuring OD600 value in UV-spectrophotometer
3) Regular interval sampling, the setting time is 1 hour, 2 hours, 4 hours, 8 hours, 12 hours after bacterial activation and growth

Result:

1) This curve suggests the growth rate of the E. coli under normal conditions. In theory, the maximum increasing speed of the growth of the E. coli is within the log phase, and as we can tell from the graph, the inflection point of the curve in this period is where the E. coli experiences the greatest reproduction rate. In this case, the point where y=0.8, time taken (x) is lesser than 4 hours, is the inflection point and we further set this position as the standard to carry on the following analysis.

2)This is the growth curve of E. coli after inserting our TurboID-FGB synthetic plasmid. This time, when y=0.8, the x value which indicates the time taken is greater than 4 hours (around 4.7 hours) which means that the growth rate of the E. coli after adding TurboID-FGB plasmid indeed had a relatively decrease. But, in terms of the final stationary phase, the total amount of the E. coli indicating by the OD600 value is slightly higher than that in normal condition (higher than 1.6 A compare with 1.6 A). Therefore, overall, we can conclude that the influence to the E. coli of adding TurboID-FGB synthetic plasmid is acceptable.

3)This is the growth curve of the E. coli after inserting our Caf1-AMP synthetic plasmid. This is an experiment that we previously concerned most about. As we are not 100% sure that AMP as an antimicrobial peptide would not pose threats to the life of the E. coli. Thus, we set this test as the experiment group, and the previous one (inserting of TurboID-FGB synthetic plasmid) as the control group. This time, the time taken for the E. coli to reach the point when y=0.8 is around 4.4 hours which is actually lower than the time taken in the control group (4.7 hours). Therefore, we can finally come out the conclusion that our Caf1-AMP synthetic plasmid will not cause harmful effects to the growth of the E. coli.

Reference:
1. MacLeod, D.T., et al. “Skin microbiology.” Encyclopedia of Microbiology, 17 Feb. 2009, pp. 734–747, https://doi.org/10.1016/b978-012373944-5.00205-4.
2. Taylor, TA, and CG Unakal. “Staphylococcus Aureus.” Europe PMC, 20 July 2017, europepmc.org/article/nbk/nbk441868.
3. “Candidiasis.” Centers for Disease Control and Prevention, Centers for Disease Control and Prevention, 28 June 2022, www.cdc.gov/fungal/diseases/candidiasis/index.html.
4. Tankeshwar, Acharya. “Pseudomonas Aeruginosa: Infections, Pathogenesis and Lab Diagnosis.” Microbe Online, 6 June 2022, microbeonline.com/pseudomonas-aeruginosa-infection-mortality-pathogenesis-and-diagnosis.
5. “Streptococcus.” Encyclopædia Britannica, Encyclopædia Britannica, inc., www.britannica.com/science/Streptococcus. Accessed 12 Oct. 2023.