Research and Brainstorm
In the initial phases of our project, we embarked on a journey to design an effective EIF6 siRNA. Our objective was to develop a sequence that could efficiently target and silence the EIF6 gene, a critical step in our efforts to enhance the drug sensitivity of apatinib against glioblastoma. To achieve this, we began with a comprehensive exploration of available tools and methodologies.
Primitive Design
Our first step was to employ the DSIR website, a reliable resource for siRNA design.
This online platform utilizes an algorithm based on the work of Vert et al. (2006) to generate siRNA sequences.
We totally synthesized three siRNA (si-EFI6#1, si-EFI6#2, si-EFI6#3) and finally chose one sequence with the highest transfection efficiency. The sequences were as follows: si-EFI6#1: sense GCUACUGUGUCUUCAGCAAUC; anti-sense UUGCUGAAGACACAGUAGCUU; si-EFI6#2: sense GAGCUUCGUUCGAGAACAACU; anti-sense UUGUUCUCGAACGAAGCUCGG; si-EFI6#3: sense GGACAGGGAGACAGAAGAAAU; anti-sense UUCUUCUGUCUCCCUGUCCAA.
Figure 1.Technical Route of Designing SiRNA
Debugging through Discussion and Consultation
Recognizing the complexity and significance of siRNA design, we acknowledged the value of collaboration and consultation. We reached out to experts in the field of siRNA delivery, including Song Furan and medical editor Xu Zhongliang. They provided us with invaluable insights and guidance on siRNA-related knowledge. Based on their recommendations, we opted to select siRNA sequences that have demonstrated higher transfection efficiency in previous studies. These collaborative discussions served as a crucial debugging phase, allowing us to critically evaluate and refine our choice of siRNA sequences.
Transfection efficiency comparison
The LN-229 glioblastoma cell line, obtained from ATCC (Manassas, VA, USA), was maintained in RPMI-1640 medium (Thermo Fisher Scientific, Inc., MA, USA) supplemented with 10% Gibco® fetal bovine serum and 100 μg/mL penicillin-streptomycin (Thermo Fisher Scientific) at 37°C in a 5% CO2 environment. Cell transfection procedures were conducted utilizing Lipofectamine™ 3000 Transfection Reagent (Invitrogen™, CA, USA), strictly following the manufacturer's guidelines.
Upon comparing the outcomes of transfection with three distinct siRNAs, it was evident that siRNA #1 exhibited the highest transfection efficiency, as depicted in Figure 1.a.
Learn and Rethink
To assess the impact of siRNA on the response to Apatinib, we need to examine the protein expression of the EIF6 gene.
Additionally, to evaluate cellular functionality, we must investigate the expression of three genes: GLUT1, HK1, and LDHA.
We designed three primers for each gene and selected one with the best specificity and efficiency. The designed primary was then synthesized by solid-phase oligonucleotide synthesis method using an automated DNA synthesizer.
From these, we will select the primer that exhibits the highest PCR efficiency for further analysis.
Final Design
Figure 2. Primer part of EIF6
Figure 3. Primer part of GLUT1
Figure 4. Primer part of LDHA
Figure 5. Primer part of HK1