igem-tokyotech logo

Adding information to the existing part

We have added documentation for future iGEM teams on existing Part to help with fluorescent protein switching in cultured cells.

pCAG-loxP_NLS_NCre_IRES_GFP_loxP_mCherry (Human)

BBa_K4419025
In TokyoTech 2023, this composite part was used to transfect Vero cells with PEI (: Polyethylenimine) (). In the 2022 experiment, these parts were incorporated into linearized vectors and introduced into Vero cells by Electroporation and Lipofection. In the 2023 experiment, these parts were incorporated into a cyclized vector and introduced into Vero cells by PEI. This experiment demonstrated a new method for introducing this composite part into Vero cells.

wet1
Fig. 0 |

A) Vero cells negative control fluorescent image, (B) Vero cells negative control bright-field image, (C) Transfected by PEI (: Polyethylenimine) vero cells fluorescent image, (D) Transfected by PEI (: Polyethylenimine) vero cells bright-field image; the scale bar is 50 µm.

Adding new basic/composite parts

We have registered Parts for future iGEM teams to help detect dengue virus genes and switch fluorescent proteins in cultured cells.

Basic Parts

dengue virus1 partial Envelope gene

BBa-K4828006
This is part of the sequence that encodes the envelope protein of dengue virus type 1. This is a dengue virus serotype-specific sequence, and the type-specific gene can be identified and detected by using primers with this sequence as the template in PCR. In PCR, we use GAACATGGAACAACTGCAACCA (BBa_K4828010) as forward primer and CCGTAGTCTGTCAGCTGTATTTCC (BBa_K4828014) as reverse primer.

dengue virus2 partial Envelope gene

BBa-K4828007
This is part of the sequence that encodes the envelope protein of dengue virus type 2. This is a dengue virus serotype-specific sequence, and the type-specific gene can be identified and detected by using primers with this sequence as the template in PCR. In PCR, we use the ACACCACAGAGTTCCATCACAGA (BBa_K4828011) as forward primer and CATCTCATTGAAGTCGAGGCC (BBa_K4828015) as reverse primer.

dengue virus3 partial Envelope gene

BBa-K4828008
This is part of the sequence that encodes the envelope protein of dengue virus type 3. This is a dengue virus serotype-specific sequence, and the type-specific gene can be identified and detected by using primers with this sequence as the template in PCR. In PCR, we use the GGACTGGACACACGCACCCA (BBa_4828012) as forward primer and CATGTCTCTACCTTCTCGACTTGTCT (BBa_K4828016) as reverse primer.

dengue virus4 partial Envelope gene

BBa-K4828009
This is part of the sequence that encodes the envelope protein of dengue virus type 4. This is a dengue virus serotype-specific sequence, and the type-specific gene can be identified and detected by using primers with this sequence as the template in PCR. In PCR, we use the GGTGACATTTAAGGTTCCTCAT (BBa_K4828013) as forward primer and AGAATGCATGGCTCCTTCCTG (BBa_K4828017) as reverse primer.

dengue virus1 envelope forward primer

BBa-K4828010
This is the forward primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 1(BBa_K4828006).

dengue virus2 envelope forward primer

BBa-K48280011
This is the forward primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 2(BBa_K4828007).

dengue virus3 envelope forward primer

BBa-K4828012
This is the forward primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 3(BBa_K4828008).

dengue virus4 envelope forward primer

BBa-K4828013
This is the forward primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 4(BBa_K4828009).

dengue virus1 envelope reverse primer

BBa-K4828014
This is the reverse primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 1(BBa_K4828006).

dengue virus2 envelope reverse primer

BBa-K4828015
This is the reverse primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 2(BBa_K4828007).

dengue virus3 envelope reverse primer

BBa-K4828016
This is the reverse primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 3(BBa_K4828008).

dengue virus4 envelope reverse primer

BBa-K4828017
This is the reverse primer used for PCR of the sequence encoding the envelope protein specific to dengue virus type 4(BBa_K4828009).

A Composite Part

pCMV-NCre

BBa_K4828018
This is based on a part (BBa_K4419025) created by 2022 iGEM Tokyo Tech, in which the promoter was changed from the CAG promoter to the CMV promoter, and kanamycin and neomycin resistance genes were also incorporated.

Transformation of this plasmid shows different behavior in the presence or absence of C-Cre (BBa_K4419010): in the absence of C-Cre, EGFP is expressed, resulting in green fluorescence; in the presence of C-Cre, mCherry is expressed, resulting in red fluorescence, as the mature Cre enzyme induces genetic recombination and fluorescence.

wetfig:2
Fig. 0 |

Analysis by agarose gel electrophoresis about pCMV N-Cre construction A: 0.6% agarose gel image, loaded with extracted pCMV N-Cre from E.coli and pCMV N-Cre digested with Afl II B: pCMV N-Cre plasmid map

Development of Education Indicators

We recognized the necessity to take measures for effectively communicating synthetic biology through educational events and as part of the STAND UP initiative, aimed at conveying the dangers of dengue fever to local people and improving their knowledge and attitudes towards it. Consequently, we collaborated with university professors of education and high school biology teachers to contemplate the approach for the event. Within this collaboration, universal insights were garnered on educational activities for enhancing knowledge and attitudes, which prompted us to reinterpret the concept of #quot;Active Learning#quot; characterized by proactive, dialogical, and deep learning, promoted by Japan's Ministry of Education, Culture, Sports, Science, and Technology, tailored for iGEM. This re-evaluation will benefit future iGEM teams when organizing educational events or activities to improve knowledge and attitudes toward diseases.
The indicators are as follows:

Teaching Materials and Slides

  • Innovate to ensure participants can recognize the issues they should learn about here
    • Make the title easily understandable
    • Introduce the theme at the beginning
  • Design to broaden the participants' interest
    • Address gaps in the current educational curriculum
    • Connect with other educational materials
  • Were there strategies to promote practical actions by participants?
    • Did it touch upon both scientific theory and its societal implementation?
    • Did it provide opportunities for participants to contemplate their future activities?

Event Format

  • Promote mutual learning among participants
    • Ensure time for group work activities
    • Provide opportunities for presenting the results of the work
  • Establish a system for organizers to learn.
    • Ensure participants have room for spontaneous activities.
    • Secure time for participants and organizers to engage both inside and outside the class.
  • Innovate to promote participants' proactive actions.
    • Address both scientific theories and their social implementation.
    • Provide an opportunity for participants to contemplate their future activities