Protocols

Seeds sterilization

---

Materials:

• 1 ml of ethanol
• 1 ml of bleach diluted in ¼
• Autoclaved water
• Seeds of Arabidopsis thaliana
• Murashige and Skoog (MS) medium plates

Procedure:

1. We introduce the seeds in an Eppendorf and add 1 mL of ethanol. Shake manually for 2 minutes.
2. Afterward, we remove the ethanol and pour 1 mL of diluted bleach. The tube is kept in a shaker for 15 minutes.
3. Remove the bleach and wash it 4 times with sterile water shaking manually
4. Sow the seeds with the pipette in the culture medium.
5. Keep the plants growing in plates at 25ºC 16 h light/8 h dark during 7 days.

Seeds sterilization

---

After 7 days growing on a plate, the arabidopsis plants are transferred to pots with soil and kept in a phytotron at 25°C 16 h light/8 h dark until the CO2 experiment.

CO₂ Exposure

---

Arabidopsis plants of 21 days old were exposed to different CO2 concentrations. We have exposed our plant during 6 and 24 hours.

Procedure:

Place half of the plants in a chamber with ambient CO2 concentration (control) and the other half in a chamber with high CO2 concentration (1,000 ppm).

Proteins extraction

---

Materials:

• Liquid nitrogen
• 25 mL extraction buffer

Procedure:

How to prepare an extraction buffer (total volume of 25 mL):

• EDTA 0.5 M pH 8: 100 µL
• HEPES 1 M pH 7: 1.25 mL
• Water: 23.65 mL

1. Grind the frozen leaves in liquid nitrogen
2. Weight 100 mg in an Eppendorf of 1.5 mL of capacity
3. Add 1000 µL of the extraction buffer
4. Vortex
5. Keep 30 minutes in an ice bucket
6. Centrifuge during 10 minutes at 14000 rpms
7. Collect the supernatant in an Eppendorf of 1.5 mL
8. Freeze at –20 ºC

Measure the concentration of proteins

---

Procedure:

We are going to use the Bradford method

Samples: Place 780 µL of water and 20 µL extract (protein) in an Eppendorf

Blank: Place 800 µL of water in an Eppendorf

Standards:

• 1 µg/µL: Place 799 µL of water and 1 µL BSA (1 mg/ml) in an Eppendorf
• 3 µg/µL: Place 797 µL of water and 3 µL BSA (1 mg/ml) in an Eppendorf
• 5 µg/µL: Place 795 µL of water and 5 µL BSA (1 mg/ml) in an Eppendorf
• 8 µg/µL: Place 792 µL of water and 8 µL BSA (1 mg/ml) in an Eppendorf
• 10 µg/µL: Place 790 µL of water and 10 µL BSA (1 mg/ml) in an Eppendorf
• 15 µg/µL: Place 785 µL of water and 15 µL BSA (1 mg/ml) in an Eppendorf
• 20 µg/µL: Place 780 µL of water and 20 µL BSA (1 mg/ml) in an Eppendorf

Add 200 µL of Dye Reagent Concentrate to all tubes (Samples, Blank and standards) Vortex. Measure in a spectrophotometer at OD595 in a period of from 5 minutes to 1 hour versus Blank.

Calculating Protein Concentration:

Prepare a standard curve of absorbance versus micrograms of protein and determine amounts from the curve. Determine concentrations of samples using the absorbance and the standard curve.

Measurement of GFP by fluorescence:

---

1. Sample preparation: add 150 µL of the protein extract of each sample in a well of a microtiter plate, leaving an empty well between samples to avoid interference between samples. The blank will be 150 µL of the protein extraction buffer.
2. Positive control: As positive control we use purified GFP (5 ng/μl). We add 10 µL of purified GFP and 140 µL of extraction buffer in a well.
3. Specifications:
   • Excitation 405 nm.
   • Emission = 515nm.
4. GFP excitation: We place the plate in the fluorometer and illuminate it with the excitation light of a specific wavelength that activates GFP fluorescence. The excitation light is absorbed by the GFP protein, which then emits light that is recorded but the flurometer. This fluorescence intensity is directly related to the amount of GFP protein present in the sample.
5. Data analysis: We collected fluorescence data from all samples and performed statistical analyses to compare fluorescence intensity between plants exposed to ambient/high CO2. This allows us to determine if there are significant differences in the expression of GFP in each plant line.

Calculating GFP Concentration:

Prepare a standard curve of fluorescence versus ng of GFP and determine amounts from the curve.

Blank: 150 µL of extraction buffer

Standards:

• 25 ng: Place 145 µL of extraction buffer and 5 µL GFP (5 ng/μl)
• 50 ng: Place 140 µL of extraction buffer and 10 µL GFP (5 ng/μl)
• 75 ng: Place 135 µL of extraction buffer and 15µL GFP (5 ng/μl)
• 100 ng: Place 130 µL of extraction buffer and 20 µL GFP (5 ng/μl)
• 150 ng: Place 120 µL of extraction buffer and 30 µL GFP (5 ng/μl)
• 250 ng: Place 100 µL of extraction buffer and 50 µL GFP (5 ng/μl)

Gateway recombination cloning technology

---

In our project is of paramount importance the construction of new in plasmids. The plasmids that contain “Inducible CO2 promoter”_”GFP”_”Terminator” were created using the Gateway technology from Invitrogen.

Production of Entry clones

The first step in this technology is to create Entry clones. They are plasmids that contain the genetic part of interest flanked by attL sequences. We generate a PCR products from the different promoters containing attB sites and clone them in pDONR/Zeo vectors through a BP reaction.

BP reaction

Materials:

• pDNOR/Zeo (150 ng/µL)
• 150 ng of PCR product
• 1 µL BP Clonase
• 6 µL TE Buffer

Procedure:

1. Mix 1 µL of BP Clonase with the 6 µL of TE Buffer and 1 µL pDONR/Zeo
2. Add 150 ng of PCR product
3. Hold at 25ºC for 1 hour
4. Store at 4ºC

Once the Entry clone is ready, the gene of interest is easily shuttled to a secondary plasmid, the Destination vector (pMDC107 plasmid). This reaction is mediated by LR Clonase.

LR reaction

Materials:

• pMDC107 plasmid
• pDONR/Zeo-inducible CO2 promoter
• 1 µL LR clonase
• 6 µL TE Buffer

Procedure:

1. Mix 1 µL of LR clonase, 6 µL of TE buffer and 150 ng of pMDC107 plasmid
2. Add 150 ng of the proper pDONR
3. Hold at 25ºC for 1 hour
4. 4. Store at 4ºC

MultiSite Gateway two-fragments cloning technology

---

The MultiSite Gateway technology facilitates rapid and highly efficient construction of an expression clone containing your choice of promoter, gene of interest, and termination sequence. We have used this strategy to construct the plasmids that contain “Inducible CO2 promoter”_”Visible reporters”_”Terminator”.

Production of Entry clones

We used the plasmid pDONR P4-P1r to produce entry clones with the promoters and pDONR/Zeo to produce the entry clones with the visible reporters. We generate PCR products from the different promoters and reporters containing specific attB sites and clone them in their respective pDONR vectors through a BP reaction.

BP reaction

Materials:

• pDNOR/Zeo (150 ng/µL)
• pDNOR P4-P1r (150 ng/µL)
• 150 ng of PCR product
• 1 µL BP Clonase
• 6 µL TE Buffer

Procedure:

1. Mix 1 µL of BP Clonase with the 6 µL of TE Buffer and 1 µL pDONR (pDONR/Zeo or pDONR P4-P1r)
2. Add 150 ng of PCR product
3. Hold at 25ºC for 1 hour
4. Store at 4ºC

LR reaction

Materials:

• R4pGWB501 plasmid
• pDONR/Zeo-inducible CO2 promoter
• pDONR P4-P1r -visible reporter
• 1 µL LR clonase
• 6 µL TE Buffer

Procedure:

1. Mix 1 µL of LR clonase, 6 µL of TE buffer and 150 ng of linearized R4pGWB501 plasmid
2. Add 150 ng of each proper pDONRs
3. Hold at 25ºC for 1 hour
4. Store at 4ºC

GoldenBraid cloning technology

---

The plasmid that contain “35S promoter”_”eYGFPuv”_”PEST sequence”_”Terminator” were created using the GoldenBraid technology. GoldenBraid is a tool for modular assembly of multigenic DNA structures in Synthetic Biology applications.

Domestication of the parts

We call “domestication” to the adaptation of basic DNA parts to the GB grammar. Domestication comprises the addition of flanking BsaI and BtgZI sites, but also the removal of internal BsaI, BsmBI and BtgZI sites. We use the pUPD2 vector for this procedure.

Domestication Protocol of eYGFPuv:

Perform a PCR amplification with the given pair of oligos:

• Oligo forward: GCGCCGTCTCGCTCGAATGACAACCTTCAAAATCGAGTC
• Oligo reverse: GCGCCGTCTCGCTCAGGCTGCCATGTCTCTTGGGGCGCTGT

Once you have the PCR product the domestication reaction should be performed as follows:

• 40 ng of PCR
• 75 ng of pUPD2
• 5-10u BsmBI
• 3u T4 Ligase
• 1 microlitre Ligase Buffer

Final volume: 10 microlitres

Domestication Protocol of PEST:

Perform a PCR amplification with the given pair of oligos:

• Oligo forward: GCGCCGTCTCGCTCGAGCCCATGGCTTCCCGCCGGAGGT
• Oligo reverse: GCGCCGTCTCGCTCAAAGCCTACACATTGATCCTAGCAGA

Once you have the PCR product the domestication reaction should be performed as follows:

• 40 ng of PCR
• 75 ng of pUPD2
• 5-10u BsmBI
• 3u T4 Ligase
• 1 microlitre Ligase Buffer

Final volume: 10 microlitres

We use Promega T4 DNA ligase(M180B) and fermentas BsmBI/Esp3I (ER0451).

Set your reaction in a thermocycler: 25 cycles x (37ºC 2', 16ºC 5').

One microlitre of the reaction is enough to be transform E.coli electrocompetent cells. Positive clones are selected in Chloramphenicol (25 microgram ml-1), IPTG (0.5mM) and Xgal (40 microgram ml-1) plates. You will distinguish between colonies carrying intact vectors (blue) and those transformed with your construction (white).

Multipartite Assembly Protocol

In order to create a new transcriptional unit you need to join GBparts using a Multipartite GB assembly reaction.

Entities to assemble: (GB0030:GB_UD_FA60:GB_UD_FA63:GB0037)pDGB1_alpha1

Reaction should be performed as follows:

• 75 ng of GB0030 (35S promoter part)
• 75 ng of GB_UD_FA60 (eYGFP part)
• 75 ng of GB_UD_FA63 (PEST part)
• 75 ng of GB0037 (Tnos part)
• 75 ng of pDGB1_alpha1
• 5-10u of BsaI
• 3u of T4 ligase
• 1 microlitre Ligase Buffer

Final volume: 10 microlitre

Set your reaction in a thermocycler: 25 cycles x (37C 2', 16C 5').

One microlitre of the reaction is enough to be transform E.coli electrocompetent cells. Positive clones are selected in Kanamycin (50 microgram ml-1), IPTG (0.5mM) and Xgal (40 microgram ml-1) plates You will distinguish between colonies carrying intact vectors (blue) and those transformed with your construction (white).

Electroporation in Escherichia coli

---

Materials:

• Gene Pulser Electroporation System (Bio-Rad).
• Electroporation cuvettes 0.1 cm gap width
• Sterile LB
• Eppendorfs of 1.5 mL
• Electrocompetent TOP 10 cells

Procedure:

1. Place electroporation cuvettes and electrocompetent cells in ice.
2. Add 1 μl of the DNA solution to the cells and transfer the mix into the cuvette.
3. Electroporate using the following following settings: 200 Ω, 25 μF, and 1.25 kV.
4. Immediately add 1 mL of LB and transfer to an Epperdorf. Shake vigorously at 37°C for 1 hour.
5. Spread 50-100 μl cells onto selective plates.
6. Incubate plates overnight at 37°C.

Miniprep

---

Materials:

• HI Bind DNA Mini Columns
• 2 mL Collection Tubes
• Solution I
• Solution II
• Solution III
• HBC Buffer
• DNA Wash Buffer
• Eppendorfs of 1.5 mL
• Water

Procedure:

We use EZNA Plasmid DNA Mini Kit.

1. Grow 5mL culture overnight.
2. Centrifuge at 10,000 x g for 1 minute at room temperature. Decant or aspirate and discard the culture media.
3. Add 250µL Solution I mixed with RNase A. Vortex to mix thoroughly. Transfer suspension into a new 1.5 mL microcentrifuge tube.
4. Add 250µL Solution II. Invert and gently rotate the tube several times to obtain a clear lysate. A 2–3-minute incubation may be necessary. Avoid vigorous mixing and do not exceed a 5-minute incubation.
5. Add 350µL Solution III. Immediately invert several times until a flocculent white precipitate forms. Centrifuge at maximum speed for 10 minutes. A compact white pellet will form. Promptly proceed to the next step.
6. Insert a HI Bind DNA Mini Columns into a 2mL Collection Tube.
7. Add 500µL HBC Buffer. Centrifuge at maximum speed for 1 minute. Discard the filtrate and reuse the collection tube.
8. Add 500µL DNA Wash Buffer. Centrifuge at maximum speed for 30 seconds. Discard the filtrate and reuse the collection tube.
9. Centrifuge the empty HI Bind DNA Mini Column at maximum speed for 2 minutes to dry the column. This step is critical for removal of trace ethanol that may interfere with downstream applications.
10. Transfer the HI Bind DNA Mini Column into a nuclease-free 1.5 mL Eppendorf tube.
11. Add 75 µL sterile deionized water. Let sit at room temperature for 1 minute. Centrifuge at maximum speed for 1 minute.
12. Store eluted DNA at -20ºC.

Plasmid cuantification

---

The microvolume spectrophotometer NanoDrop, is a specialized instrument designed to measure the concentration and purity of nucleic acids (DNA, RNA) and proteins in small sample volumes.

Here's how a Nanodrop works:

• Sample Application: A small droplet (usually 1-2 μL) of the sample is placed onto a specialized surface, typically a quartz or disposable plastic pedestal.
• Absorbance Measurement: The NanoDrop reads concentration by assessing the absorbance at 260 nm, this is the wavelength at which DNA is absorbed.
• Calculation of Concentration: Based on the absorbance measurements at the appropriate wavelengths, the Nanodrop software calculates the concentration of nucleic acids in the sample. For nucleic acids, the concentration is usually expressed in units of ng/μL.

Digestion and electrophoresis

---

We cut the plasmids using specific restriction enzymes and then we analyze the fragments by gel electrophoresis to confirm that our plasmids are correctly formed.

Materials:

• 2 µL Buffer
• 0.5 µL of each specific enzyme
• 1 µg of plasmid
• Water up to 20 µL

Procedure:

1. Mix everything in 1.5 ml Eppendorf tubes and incubate the reaction at digestion temperature (usually 37 °C) for 1 hour.
2. After it’s done, we run the samples in an electrophoresis to check the size of the fragments.

Preparation of agarose gel

Pour the 1% agarose with 15 µL of Midori Green into a gel tray with the well comb in place. We have to wait until it solidifies. Then we remove the comb and move the gel to the electrophoresis cuvette. We cover the gel with TAE 1%.

To prepare the samples we add 2 µL of loading buffer to the digestions. We load the samples into the wells of the gel. We load 7 µL of the molecular weight ladder into the first lane of the gel.

Run the gel at 80-150 V until the dye line is approximately 75-80% of the way down the gel. Afterward, we take the gel to a device that has UV light and take a photo to analyze the results.