Contribution

Introduction

Over the course of history, limestone has played an essential role in the building of countless architectural gems. Maastricht is a great example of a city that is filled with evidence of its historical importance. Unfortunately, limestone is a sedimentary rock that is easily weathered by rain cycles, humidity and other factors. We, at Sublimestone, hope to keep this cultural and historical heritage intact for many generations to come.

Info

This page aims to provide an overview of our team's contribution to other iGEM teams and the scientific community. It highlights the collaborative efforts, knowledge sharing, and support we hope to provide to help other teams succeed in their projects.

---

As a team, we believe in the power of collaboration and the importance of sharing knowledge within the iGEM community. Through our collaborative efforts, we aim to foster a supportive and inclusive environment where teams can learn from each other and thrive together.

Our team's contribution to other iGEM teams is not limited to the competition period. We believe in the long-term impact of our collaboration. With this page we hope to provide future teams with the knowledge to potentially build further on and improve our modules.

DNA-Origami

To achieve our desired design, we investigated current DNA origami techniques. We would like to offer our current knowledge and share the tools that we used throughout our project.

Info

DNA origami is a technique that allows for the fabrication of complex nanostructures through guided DNA folding (Majikes & Liddle, 2021).^[1]

The theory

The theory behind DNA origami involves designing a long single-stranded DNA (ssDNA) molecule, referred to as a scaffold, which acts as a backbone for the assembly. The scaffold is then forced into a particular shape using short ssDNA strands called staples that are designed to be complementary to a specific site in the scaffold.

Info

The following will focus on designing DNA origami sequences for the construction of regular 3D shapes such as an octahedron.

In order to ensure that the DNA origami design has the best-fitted shape to serve as a scaffold, there are several criteria that need to be addressed. Firstly, the structure needs to support the formation of a lattice or chains, facilitating the creation of extended structures with interconnected units.

Additionally, the lattice has to provide nucleation sites for calcite mineralization, which can be ensured by designing a shape with many vertices that expose the DNA phosphate backbone (Zhang et al., 2023).^[2]

Mechanical strength is another crucial consideration, ensuring the stability and integrity of the lattice under diverse environmental conditions (Zhai et al., 2021).^[3]

---

Lastly, thermodynamic stability is essential, assuring that the octahedral structure will maintain its integrity, resisting disassembly or rearrangement (Julin et al., 2020).^[4]

The main challenge behind the design of 3D shapes is the angle formed at each vertex. These need to be a precise angle to allow the whole structure mechanistic strength.

To achieve this, some staples are defined as vertex staples. These staples have a short repeat of T bases that allow the staple to bend to a fixed degree.

DNA-origami scaffold sequence

BioBrick part:

BBa_K4665170

Description:

This part contains the 3024bp long sequence that was used in our project to generate our DNA origami lattice (Nafisi et al., 2018).^[5]

This scaffold sequence must first be converted to a ssDNA sequence before being suitable for folding experiments. In our project, we followed the protocol created by Noteborn et al. (2022).^[6] First, the dsDNA scaffold sequence was amplified using a standard primer (5' GGGATTCATGGTGTATTGCTTCACC 3') in combination with a modified primer containing 5 phosphorothioate linkages(5'CATAT*GACGCGCCCTGTAGC 3'). These linkages are introduced at the first 5 base pairs of the 5' end of the desired scaffold strand. After PCR, the phosphorothioate-modified scaffold can be selectively digested with T7 exonuclease (obtained from New England Biolabs). This enzyme will degrade the strand lacking phosphorothioate linkages from the 5' to the 3' end, while the phosphorothiate-modified strand remains protected against T7 exonuclease digestion.

To get the ssDNA sequence, a pScaf phagemid with insert for generating DNA origami was used. This phagemid was constructed by Nafisi et al., (2018).^[5:1] They converted pUC18 into a phagemid for custom ssDNA production by adding four components: 1) a full-length M13 origin for ssDNA initiation. 2) Kpnl and BamHl restriction sites for insert cloning. 3) M13 PS for phage particle export. 4) modified M13 origin to serve as the ssDNA synthesis terminator.

Unique Features/Contributions:

In the table below you can find the staples we engineered that are complementary to the 3024bp scaffold. These staples is what allows the ssDNA to fold into its octahedral form.

Building a DNA origami Lattice: Sticky End Algorithm

To further our DNA origami design, we share an algorithm which purpose is to extend a basic origami shape into a lattice. This algorithm takes in a PDB construct and establishes the following:

1. Whether the input can be extended into a lattice
   
   

2. Which staples need to be extended for a lattice
   
   

3. Generates complimentary sticky ends for the input

4. Builds the PDB files and returns the modified sequences.

The resulting sticky ends are extensions of existing staples that can bind to their complementary pair on the opposite side of the DNA origami shape. By connecting multiple structural DNA origami into a higher order structure, it is possible to construct materials of a few micrometres in size of which we can control the shape and functionality.

Info

Our algorithm can be found here.

Reference

---

1. Majikes, J.M. & Liddle, J.A. (January 8, 2021). DNA Origami Design: A How-To Tutorial. Journal of Research of the National Institute of Standards and Technology, 126:126001. https://doi.org/10.6028/jres.126.001 ↩︎

2. Zhang, Z. (November 26, 2019). Use of Genetically Modified Bacteria to Repair Cracks in Concrete. Materials, 12(33). https://doi.org/10.3390/ma12233912 ↩︎

3. Zhai, Y., et al., (2021). Mechanical property of octahedron Ti6A14V fabricated by selective laser melting.Reviews on Advanced Materials Science, 60(1), 894-911. https://doi.org/10.1515/rams-2021-0080 ↩︎

4. Julin, S., et al., (2022). Dynamics of DNA Origami Lattices. Bioconjugate Chemistry, 34(1), 18-29. https://doi.org/10.1021/acs.bioconichem.2c00 ↩︎

5. Nafisi, P. M. et al., (2018) Construction of a novel phagemid to produce custom DNA origami scaffolds, Synthetic Biology, Volume 3, Issue 1, https://doi.org/10.1093/synbio/ysy015 ↩︎ ↩︎

6. Noteborn, W. E. M. et al., (2020). One-Pot synthesis of Defined-Length SSDNA for multiscaffold DNA origami. Bioconjugate Chemistry, 32(1), 94–98. https://doi.org/10.1021/acs.bioconjchem.0c00644 ↩︎