Design
Every design for our experiments
Why We Chose Aptamer & CEA N Domain?
Aptamer
Aptamers are artificially created single-stranded sequences of DNA or RNA obtained from combinatorial libraries of oligonucleotides using the established in vitro selection and iterative process known as SELEX [1]. They possess the ability to attach to a specific target by creating secondary and/or tertiary structures.
Aptamers represent a promising group of molecules often likened to the chemical counterparts of antibodies. Monoclonal antibodies (mAbs) are acknowledged as immensely valuable tools in contemporary medicine, serving various therapeutic and diagnostic purposes. While aptamers share similarities with traditional antibodies, they offer certain advantages, such as robust chemical stability and the ability for rapid and cost-effective mass production. Moreover, they can be manufactured at a large scale with reduced expenses, all while maintaining excellent reproducibility and dependability [2].
![Fig. 2. Table for Comparing the Characteristics of Aptamers and Antibodies [2]](https://static.igem.wiki/teams/4953/wiki/design2.png)
CEA N Domain
The criteria for selecting a biomarker for cervical cancer diagnosis are as follows:
1. Substance specifically found in cervical cancer patients.
2. Substance secreted extracellularly through serum.
3. Substance for which there is an aptamer for protein binding.
4. Substance not influenced by external factors such as hormones.
After reviewing various literature, CEA (carcinoembryonic antigen) was selected as a substance that meets these criteria. The rationale for this choice is as follows:
Although CEA is not a conventional biomarker for cervical cancer diagnosis and is widely known as a specific biomarker for colon cancer, some literature [3] suggests the potential use of this protein as a biomarker for cervical cancer.
We concluded that CEA protein could be utilized for the diagnosis of cervical cancer, given the unique nature of menstrual fluid as our sample.
Moreover, multiple studies have confirmed that CEA is secreted through serum, and it can be detected through blood tests [3,4].
Furthermore, through a literature review, we were able to find a preceding study [5] that discovered aptamer sequences for CEA. In this paper, aptamers were selected using the SELEX technique, ultimately presenting six aptamer candidates. It appears that the research team chose N54 and N56 for their study.
Based on these pieces of evidence, we concluded that CEA is the most suitable biomarker for our project.
Key Mechanisms of CEApture
Overview
The principle of CEApture is as follows:
1. CEApture is a sensor attached to the bottom layer of a sanitary pad.
2. The biomarker is CEA (protein), and the aptamer is N56 (aptamer).
3. Two complementary DNA strands related to N56 aptamer are immobilized on the pad using streptavidin:
• cDNA1 - complementary DNA to the region where the aptamer and the target protein bind. (test line)
• cDNA2 - complementary DNA to the region where the aptamer and the target protein do not bind. (control line)
4. CEA protein from menstrual/vaginal fluid is absorbed onto the pad.
5. N56 bound to AuNP forms a complex with CEA.
6. It flows along the pad, passing through the test line and control line.
7. The N56-CEA complex binds only to the control line.
8. Individuals with CEA in their bloodstream, indicating a positive reaction, can observe a red line only at the control line.
9. Users can review the test results on the backside of the sanitary pad, where the LFA kit is displayed through a transparent section.
Cell-free systems can largely eliminate the constraints and complexities inherent in cell host use. A substantial limitation of cell-based synthetic biology is the requirement for laborious genetic encoding of its design features into a living cell, which can limit its functionality and significantly slow down design–build–test cycles.
Cell-free systems offer a means to circumvent many of these limitations. They were originally conceived as tools to facilitate in vitro protein synthesis and consist of molecular machinery extracted from cells. They typically contain enzymes necessary for transcription and translation, and accordingly can perform the fundamental processes of the central dogma independent of a cell. Also, the open nature of CFS means that there are no physical barriers to programming and modification. Conceptual designs can go from computational instructions to chemical synthesis and amplification to CFS without the need for selective markers or cell-based cloning steps. Such simplicity allows for rapid prototyping of molecular tools. This implies the possibility that if the DNA template can be changed through CFE, a sensor can be designed to diagnose a new disease by binding with another type of aptamer existing or discovered through AI modeling [6].
In addition, in the future, N56 aptamer can be used as a synthetic biological component that can diagnose other diseases with increased CEA N domain expression. This could be used as a good 'chemical antibody' that can quickly diagnose various tumors as well as cervical cancer.
1. Aptamer Selection
Dry Lab; AI Modeling
As mentioned earlier, through a literature review, we identified a study that investigated aptamers specifically binding to the CEA N domain [5]. In this study, a total of six aptamer candidates were ultimately presented. To find the aptamer with the highest binding affinity among them, we conducted modeling.
| N54 | GACGATAGCGGTGACGGCACAGACGTCCCGCATCCTCCGCCGTGCCGACCCGTATGCCGCTTCCGTCCGTCGCTC |
|---|---|
| N56 | GACGATAGCGGTGACGGCACAGACGCCCCAGGAAGAACCTACTCACTGATCGTATGCCGCTTCCGTCCGTCGCTC |
| N57 | GACGATAGCGGTGACGGCACAGACGCACCGCTCTTATGCCACCATTTTCACGTATGCCGCTTCCGTCCGTCGCTC |
| N59 | GACGATAGCGGTGACGGCACAGACGCCGCTACCCCATCCACGCCAATCCCGTATGCCGCTTCCGTCCGTCGCTC |
| N65 | GACGATAGCGGTGACGGCACAGACGCCCGCATCCTCCGCCGTGCTGACCCCGTATGCCGCTTCCGTCCGTCGCTC |
| N71 | GACGATAGCGGTGACGGCACAGACGAAATCCCCGCTGAATTACCACTTTACGTATGCCGCTTCCGTCCGTCGCTC |
For modeling, we utilized the HDock model. The HDock model is an AI-based model that predicts protein-protein and protein-DNA/RNA docking.
The results of HDock modeling indicated that among the six aptamers, N56 exhibited the highest binding affinity with the protein.
For more detailed information regarding the modeling, you can refer to model
| N54 | N56 | N57 | N59 | N65 | N71 | cApt | Docking score | -219.07 | -226.66 | -218.33 | -226.18 | -219.93 | -217.00 | -221.87 | Docking score | 0.7992 | 0.8225 | 0.7968 | 0.8211 | 0.7925 | 0.8081 |
|---|
Wet Lab; Protein-Aptamer Docking(PAD) Experiment with H-NMR Spectroscopy
Protein-Aptamer Docking (PAD) experiment is a vital method for visually assessing the binding patterns within aptamer-protein complexes. This analysis is essential due to a significant scientific limitation in assuming that an aptamer can be used effectively in lateral flow assays (LFA) solely based on its binding capability.
Why is it important for an aptamer to exhibit nearly perpendicular binding to a biomarker to be considered suitable for LFA?
The primary reason why an aptamer must bind almost perpendicularly to a biomarker to be considered suitable for LFA is as follows:
1.Aptamers are nucleic acids, and for chemical fixation to nanoparticles or LFA sheets, we can only secure them at their ends since only these termini exhibit chemically active reactivity. In essence, for LFA applications, whether the aptamer is attached to a nanoparticle or integrated into an LFA sheet, it can only be affixed at one end.
2.Significant chemical repulsion forces, notably “steric hindrance”, become highly pronounced near regions already chemically bonded or fixed. This is a well-established fact, and as reported in various papers, it's stated that "due to steric hindrance, aptamers immobilized closely to surfaces may not be able to assume the three-dimensional structure necessary for target recognition" [7].
3.Consequently, it is highly improbable for a relatively large biomarker to bind to the side of an aptamer immobilized on an LFA sheet due to the substantial steric hindrance. Naturally, if the aptamer is exceptionally long and linear, the biomarker might attach to the side. However, such an aptamer would be structurally unstable and unsuitable for use as a probe.
4.Hence, an aptamer suitable for LFA must bind a biomarker to one of its loops or ends, excluding the fixed end. To express this requirement, we refer to it as "binding almost vertically (or perpendicularly)" in this document.
Only aptamers that meet these conditions can be effectively employed in LFA using the aptamer method. To address this need, we have conducted the Protein-Aptamer Docking (PAD) experiment as a means to observe and validate the binding patterns between aptamers and proteins.
Meanwhile, to perform the PAD experiment, we first performed H-Nuclear Magnetic Resonance(NMR) spectroscopy to analyze the structure of the CEA protein and N56 aptamer. We analyzed the structures of N56 aptamer and CEA protein by analyzing peak and integral values of H-NMR data. Then, the PAD experiment was conducted by converting the H-NMR data into data suitable for the PAD experiment.
In preparation for the PAD experiment, we initially carried out H-Nuclear Magnetic Resonance (NMR) spectroscopy to examine the structures of both the CEA protein and the N56 aptamer. Our analysis involved studying the peak splitting phenomenon and integral values from the H-NMR data for both the N56 aptamer and the CEA protein. Furthermore, the structure of the protein-aptamer complex was also analyzed by H-NMR, and the data was compared with the data before binding. Subsequently, we transformed this H-NMR data into a format suitable for the PAD experiment.
2. CEA N Domain Template DNA Design
A template DNA was designed to express the CEA N domain protein cell-free. According to the NEBExpress Cell-Free Protein Synthesis System manual, the CEA N domain gene sequence was inserted into the pET-28a(+) vector with the T7 promoter. Nde1 was set as the 5' cloning site, and Xho1 was set as the 3' cloning site. In addition, a vector was designed to express 6x His-tag for protein purification after cell-free expression.
3. Cell-Free Expression of CEA N Domainn
Cell-free gene expression (CFE) uses cellular machinery to synthesize proteins from natural or synthetic DNA without cells. It creates an environment in test tubes that mimics essential cellular functions. CFE involves isolating transcription and translation components from cells to make a genetic material-free lysate. This lysate is enriched with buffers, ribonucleosides, amino acids, ATP systems, and cofactors for flexibility in engineering biological systems [8].
CFE has potent capabilities, enabling independent experiments from the cell's genome. It facilitates high-throughput testing of various genetic constructs and offers portability for diverse applications. In synthetic biology, CFE is pivotal, providing a controlled platform for protein synthesis and system engineering outside of cells. It's used for genetic circuit assembly, gene expression studies, and novel biological function design. CFE's adaptability makes it a valuable tool for our project [8].
4.EMSA
The electrophoretic mobility shift assay (EMSA), conducted through gel electrophoresis, is employed to identify protein complexes that interact with nucleic acids. This technique forms the foundation for various qualitative and quantitative analyses to understand interacting systems better. In the traditional procedure, solutions containing both proteins and nucleic acids are mixed and then subjected to electrophoresis under natural conditions using either polyacrylamide or agarose gel [10].
In our project, we have conducted EMSA to confirm the binding between the N56 aptamer and the CEA protein. We tagged FAM(Fluorescein phosphoramidite) to the DNA aptamer to check the mobilization of the aptamer-protein complex.
5. Lateral Flow Assay (LFA)
The lateral flow assay (LFA) is a convenient paper-based method for detecting analytes in complex mixtures. In our project, we use aptamers in LFAs instead of antibodies. Aptamers offer advantages explained in more detail above and in the Description page.
When the target is present, it competes with the complementary sequence for aptamer recognition, resulting in a weaker or no signal. Without the target, the aptamer/reporter complex is easily captured by the immobilized complementary sequence on the test line, leading to a strong band [11].
In summary, a single line is expected for the CEA protein-positive group, while the negative group shows two lines. This LFA is attached to the bottom of a sanitary pad, and users can check results through the pad's transparent film.
Reference
[1] P. Kumar Kulabhusan, B. Hussain, and M. Yüce, “Current Perspectives on Aptamers as Diagnostic Tools and Therapeutic Agents,” *Pharmaceutics*, vol. 12, no. 7, Jul. 2020, doi: https://doi.org/10.3390/pharmaceutics12070646.
[2] M. M. Aljohani, D. Cialla-May, J. Popp, R. Chinnappan, K. Al-Kattan, and M. Zourob, “Aptamers: Potential Diagnostic and Therapeutic Agents for Blood Diseases,” *Molecules*, vol. 27, no. 2, p. 383, Jan. 2022, doi: https://doi.org/10.3390/molecules27020383.
[3] S. Dasari, R. Wudayagiri, and L. Valluru, “Cervical cancer: Biomarkers for diagnosis and treatment,” *Clinica Chimica Acta*, vol. 445, no. 7–11, pp. 7–11, May 2015, doi: https://doi.org/10.1016/j.cca.2015.03.005.
[4] V. L. Kankanala and S. K. R. Mukkamalla, “Carcinoembryonic Antigen,” *PubMed*, 2022. https://www.ncbi.nlm.nih.gov/books/NBK578172/
[5] E. W. Orava, Aws Abdul-Wahid, E. J. Huang, Amirul Islam Mallick, and J. Gariépy, “Blocking the attachment of cancer cells in vivo with DNA aptamers displaying anti-adhesive properties against the carcinoembryonic antigen,” *Molecular Oncology*, vol. 7, no. 4, pp. 799–811, Aug. 2013, doi: https://doi.org/10.1016/j.molonc.2013.03.005.
[6] A. Tinafar, K. Jaenes, and K. Pardee, “Synthetic Biology Goes Cell-Free,” *BMC Biology*, vol. 17, no. 1, Aug. 2019, doi: https://doi.org/10.1186/s12915-019-0685-x.
[7] J.-G. Walter, Ö. Kökpinar, K. Friehs, F. Stahl, and T. Scheper, “Systematic Investigation of Optimal Aptamer Immobilization for Protein−Microarray Applications,” *Analytical Chemistry*, vol. 80, no. 19, pp. 7372–7378, Aug. 2008, doi: https://doi.org/10.1021/ac801081v.
[8] D. Garenne, M. C. Haines, E. F. Romantseva, P. Freemont, E. A. Strychalski, and V. Noireaux, “Cell-free gene expression,” *Nature Reviews Methods Primers*, vol. 1, no. 1, pp. 1–18, Jul. 2021, doi: https://doi.org/10.1038/s43586-021-00046-x.
[9] A. Robert, “TXTL: A Cell-Free Transcription/Translation Process,” *app.biorender.com*, 2020. https://app.biorender.com/biorender-templates/t-5f984301b8682300abea1060-txtl-a-cell-free-transcriptiontranslation-process (accessed Oct. 05, 2023).
[10] L. M. Hellman and M. G. Fried, “Electrophoretic mobility shift assay (EMSA) for detecting protein–nucleic acid interactions,” *Nature Protocols*, vol. 2, no. 8, pp. 1849–1861, Jul. 2007, doi: https://doi.org/10.1038/nprot.2007.249.
[11] T. Wang *et al.*, “Development of nucleic acid aptamer-based lateral flow assays: A robust platform for cost-effective point-of-care diagnosis,” *Theranostics*, vol. 11, no. 11, pp. 5174–5196, Mar. 2021, doi: https://doi.org/10.7150/thno.56471.
[12] K. M. Koczula and A. Gallotta, “Lateral flow assays,” *Essays In Biochemistry*, vol. 60, no. 1, pp. 111–120, Jun. 2016, doi: https://doi.org/10.1042/ebc20150012.
[13] “Addgene: CEA-N domain residues 1-132 (CEACAM5)-pET30b,” *www.addgene.org*. https://www.addgene.org/174693/ (accessed Oct. 08, 2023).
[14] “Addgene: Vector Database - pET-28 a (+),” *www.addgene.org*. https://www.addgene.org/vector-database/2565/ (accessed Apr. 13, 2021).
[15] L. V. Volkova, A. I. Pashov, and N. N. Omelchuk, “Cervical Carcinoma: Oncobiology and Biomarkers,” *International Journal of Molecular Sciences*, vol. 22, no. 22, p. 12571, Nov. 2021, doi: https://doi.org/10.3390/ijms222212571.