Our dream is to construct a biological filter that would degrade phthalic acid esters (PAE), removing these hazardous compounds from water. By reviewing the literature, we adapted a hypothetical enzymatic pathway for the degradation of phthalates, utilizing two enzymes from two different bacterial species. We selected two esterases and four decarboxylases that could potentially catalyze the chemical reactions we identified. We also designed a method of immobilizing them to cellulose, using a structure adapted from cellulosome – a protein complex used by cellulolytic bacteria. Our adaptive cellulosome consists of a multifunctional integrative scaffolding subunit responsible for organizing various enzyme subunits into a complex. We have constructed seven new devices using BioBricks™ with sequences encoding our fusion proteins of interest. Above that, we optimized our sequences to undergo efficient expression in Escherichia coli cells. We also wanted to maximize the modularity of our devices, so that they contain interchangeable elements, such as promoters, terminators, or coding sequences. To achieve that we used parts from the iGEM DNA Distribution Kit plate. Because we planned on working with E. coli strains, we decided to prepare our composite parts using the "E. coli Protein Expression Toolkit".
Using the naturally occurring cellulosome, we designed a protein scaffold (ScfL-His device; BBa_K4695230) (Fig. 1b) that has a cellulose-binding domain (CBD) which strongly binds the entire complex to cellulose. Our synthetic mini-cellulosome (Fig. 1a) construct is equipped with three different cohesins which enables it to bind three different dockerins (which has a high affinity for a particular type of cohesin). Using synthetic biology and thanks to the modularity of our system, we can immobilize and test different enzymes on the same scaffold.
Figure 1. Graphic presentation of scaffoldin. a) The scheme represents construction of scaffoldin containing three different cohesins and cellulose-binding domain. b) ScfL-His device (BBa_K4695230) generated with snapgene software. The diagram shows components from iGEM distribution kit plate and our original component.
One group of enzymes that are capable of degrading phthalates are esterases, which catalyze the hydrolysis reaction of ester bonds. For testing, we selected two esterases (derived from Bacillus subtilis strain BJQ0005 and soil metagenomic libraries) and prepared with their use composite parts (Fig. 2b), i.e. PnbA-DocScaB device (BBa_K4695210) and EstJ6-DocScaB device (BBa_K4695211), respectively. In our constructs, the esterases were in fusion with docerin DocScaB (BBa_K4695041), thus enabling future immobilization on scaffoldin (Fig. 2a).
Figure 2. Graphic presentations of esterases. a) The scheme represents construction of esterase in fusion with docerin domain. b) EstJ6-DocScaB device (on top) and PnbA-DocScaB device (on bottom) generated with Snapgene software. The diagram shows components from iGEM distribution kit plate and our original components.
Decarboxylases are group of enzymes that allow the detachment of the carboxyl group. In our research, we selected four decarboxylases from Pantoea dispersa strain BJQ0007 and designed constructs: Dcx1-DocXylY device (BBa_K4695220), Dcx2-DocXylY device (BBa_K4695221), Dcx3-DocXylY device (BBa_K4695222) and Dcx4-DocXylY device (BBa_K4695223) (Fig. 3b). These enzymes will perform the decarboxylation of monobutyl phthalate to butyl benzoate, which should increase the yield of the formation of the of the target benzoic acid. Each of our decarbosylases has been prepared in fusion with dockerin DocXylY (BBa_K4695040) (Fig. 3a).
Figure 3. Graphic presentations of decarboxylases. a) The scheme represents construction of decarboxylase in fusion with docerin domain. B) The following sequences are presented from the top Dcx1-DocXylY device, Dcx2-DocXylY device, Dcx3-DocXylY device and Dcx4-DocXylY device generated with Snapgene software. The diagram shows components from iGEM distribution kit plate and our original components.
In our project, we also prepared the sequences of a third DocCel48A dockerin (BBa_K4695042), showing affinity for one of the cohesins of scaffoldin. In the future, it can be used to attach an indicator (e.g., green fluorescent protein - GFP) or another enzyme to improve the water purification process (Fig. 4).
Figure 4. The graphic presentation of our system, constructed from protein scaffold scaffoldin and enzymes fused with dockeryns.
In addition to designing the coding sequence, we have also prepared primers that allow us to confirm the correctness of element assembly (Table 1). We have prepared primers complementary to each element of our devices (Fig. 5). We conducted PCR analyses, which confirmed the functionality of our sequences; however, we did not have enough time to verify all of them, more information is available in experiments.
Table 1. List of our designed primers. We did not have a chance to confirm the functionality of all the primers; the information regarding this can be found in the last column. Tm - melting tempreture.
| Primer name | Element with complementary sequence | Sequence | Tm [°C] | Does it work? |
|---|---|---|---|---|
| FecT_295_F | BBa_J435330 | CAAGACGTTTCCCGTTGAAT | 60.0 | NOT TESTED |
| Prom_296_F | BBa_J435350 | ACTAGAGGGCGGCGTAGAG | 59.6 | YES |
| RBS_348_R | BBa_J435385 | CGAAAATTGCTTTCATTGTTGA | 60.1 | YES |
| DT4_274_R | BBa_J435309 | ACCTGATCCACCGCCAGA | 62.7 | DURING TESTING |
| T5E_332y_R | BBa_J435369 | TCATTAGTGATGGTGATGGTGA | 58.9 | YES |
| Term_324_R | BBa_J435361 | AACCCCTCAAGACCCGTTTA | 60.7 | YES |
| VecT_295_R | BBa_J435330 | CGGAGCCTATGGAAAAACAA | 60.1 | NOT TESTED |
| DT4_357_R | BBa_J435395 | TTGAAAATAAAGATTTTCGCTTCC | 60.0 | YES |
| Scaf_R | BBa_K4695030 | GGAGCTTCCGGTGTTTGTTA | 60.1 | DURING TESTING |
| Karb_1_R | BBa_K4695020 | CGGACCTTCGTTTTTCATGT | 60.0 | NOT TESTED |
| Bok_2_R | BBa_K4695021 | AAATTTTGGCGTTCCTTGTG | 60.0 | NOT TESTED |
| Laz_3_R | BBa_K4695022 | CCCATGTAATTCCAGGATGG | 60.0 | NOT TESTED |
| Aza_4_R | BBa_K4695023 | AAAAGTGGGATGTGCCAGTC | 60.0 | NOT TESTED |
| Est_1_R | BBa_K4695010 | ATTTTGGGAGGGGGTATCTG | 60.0 | YES |
| Str_2_R | BBa_K4695011 | CATACCCAGCAGACCCTGTT | 60.0 | NOT TESTED |
| Cer_1_R | BBa_K4695040 | CAGGTAACGAGACAGCAGCA | 60.2 | NOT TESTED |
| Ock_2_R | BBa_K4695041 | AACCGGGAACAGGAAGATTT | 59.8 | YES |
| Yna_3_R | BBa_K4695042 | CGCGTCGTCAGAGTTGATAA | 60.0 | NOT TESTED |
| fJUMP_1_F | BBa_J428347, BBa_J428350, BBa_J428353, BBa_J428341 | CGTTCACCGACAAACAACAG | 60.2 | YES |
| pJUMP_1_R | BBa_J428347, BBa_J428350, BBa_J428353, BBa_J428341 | GTTATCACGCGCCCATTTAT | 59.8 | YES |
| BglII_F | BBa_K4695030 | GGGAGATCTATCGAGGTCTCAAATGGTATCAG | 69.9 | NOT TESTED |
| Rxho_R | BBa_K4695030 | CGCCTCGAGTTATCGATGGTCTCGACCTCCTT | 77 | NOT TESTED |
Figure 5. The diagrams show expression vectors containing designed devices: the PnbA-DocScaB device (BBa_K4695210) on the left and the ScfL-His device (BBa_K4695230) on the right. The designed primers are complementary to each biobrick used in the construction of our devices, highlighted in purple on the diagram. The diagrams were generated using Snapgene software.
