To investigate the interference effect of RNAi, we conducted biological tests on Plagiodera versicolora using different experimental groups. We recorded the pupation rate, emergence rate, and weight change of Plagiodera versicolora over a seven-day period, corresponding to the seventh to fourteenth day of the growth cycle.
Obtain detached leaves from the willow tree and place them on wet filter paper inside a petri dish (diameter 6.5cm, height 1cm). The leaf size is 3cm long and 1.5cm wide. Apply our engineered bacteria B3-3G, B3-3G+KC5, B3-3G+KC6,KC-P+KC5, KC-P+KC6 and blank control H2O onto the detached leaves at a rate of 4ng/cm2. After the leaves naturally air dry, transfer a total of 10 second instar Plagiodera versicolora larvae onto the detached leaves using a fine brush (six replicates per group, n=60). The number of dead insects is measured daily. After 4 days of feeding, take photos of the consumed leaf area and record the weight of the larvae in three groups (1-4d). Figure 1 shows the leaf consumption situation of Plagiodera versicolora after 4 days feeding. Figure 2 shows the change in average weight (in mg) of Plagiodera versicolora after feeding. Figure 3 shows the relative survival rate of Plagiodera versicolorale with feeding time (Days after feeding). Figure 4 shows the paputioon rate of Plagiodera versicolora in each group after feeding. Figure 5 shows the emergence rate of Plagiodera versicolora in each group after feeding.More details can be found at project.
Figure 1 Leaf feeding status
On the fourth day, the blank control group leaves were mostly eaten, while the Pseudomonas chlororaphis group consumed slightly less compared to the blank control group. Even more gratifyingly,the leaves from the KC-P+KC5 group were consumed very little.
Figure 2 Mean weight of larval
RNA interference not only causes the death of insects, but also hinders the growth and development of insects, and dsRNA intake reduces adult body weight by about 50% compared to the control group.
Figure 3 Survival rate
We started feeding from the second instar Plagiodera versicolora’s Subphylum A, and it is evident that the expression of actin protein gene dsRNA strain significantly increases the mortality rate of insects, especially in the early stages of their growth.
Figure 4 Pupation rate
The pupation rate of the control group was 81.67% and the groups treated with Pseudomonas chlororaphisand all other groups that not express dsRNA that coding actin protein decreased to some extent, but remained around 70%. The pupation rate of the experimental group treated with B3-3G+KC5, which introduced the dsRNA expression vector（coding actin protein）, decreased to 35.00%. And the pupation rate of the experimental group KC-P+KC5 , where ribozyme III was knocked out, decreased significantly to 6.67%.
Figure 5 Emergence rate
In comparison to the pupation rate, the feathering rate of the Plagiodera versicolora generally decreased. The feathering rate of the control group was 73.33%. However, the feathering rate of the experimental group treated with B3-3G+KC5 decreased to 25.00%, and the experimental group treated with KC-P+KC5 showed a further decrease to 6.77%.
To survey whether the accumulation of dsRNA of mutant increased or not After knockout of Pseudomonas chlororaphis RNase III, using the actin sequence as a probe, we conducted Northern blot. The amount of dsRNA could be checked by the strength of the hybridization signal.
Figure 6: Northern blot detection results. From left to right: Marker, KC-P+KC1, KC-P+KC2, B3-3G, B3-3G+KC1, B3-3G+KC2.
Based on Figure 6, we can clearly observe the mutant had a significant increase of the accumulation of actin-dsRNA . This suggested that ribozyme III knockout favored dsRNA accumulation.
To test the effectiveness of the constructed KillerRed safety switch, we introduced plasmids carrying the KillerRed gene into Pseudomonas putida and obtained the corresponding transformants, which were cultured on a larger scale. A appropriate amount of bacterial cells was taken, spread on agar plates, and placed at a distance of 50 cm from a 300W incandescent lamp for cultivation at different times. Then, the plates were incubated overnight in a dark incubator. By counting the colony-forming units (CFUs) on the agar plates, we visually assessed the effectiveness of the KillerRed safety switch.
Figure 7 The agar plates after 0 hours, 0.5 hours, 1 hour, and 2 hours of light exposure
It can be observed that the number of bacterial colonies decreased to less than 20% after half an hour of light exposure, and one hour of irradiation was able to kill more than 95% of bacteria, indicating that the KillerRed safety switch has a significant effect
To verify that the results of our biological tests on Plagiodera versicolora were indeed caused by RNA interference (RNAi), we conducted qRT-PCR at the molecular level to determine the expression levels of the actin gene in different groups of Plagiodera versicolora on the third day of feeding.
In our experiment the total RNA was extracted from Plagiodera versicolora on the third day of feeding, and mRNA was used as a template for reverse transcription into cDNA using Random primers/Oligo(dT)18 primer. Then, the cDNA was used as a template for real-time fluorescence quantitative PCR (qRT-PCR) amplification of the target gene using specific primers, with 18S selected as the housekeeping gene. The relative expression levels of the target gene were calculated using the 2-ΔΔCT method.
The primer sequences for qRT-PCR amplification of the reference gene 18S are as follows:
q-PV-18s-F: CTTCCTCGTCGGAGCATTCT.
q-PV-18s-R: GTTCGCCTTAACTGCCATCAA.
The primer sequences for qRT-PCR amplification of the actin gene are as follows:
q-PV-ACT-F: CGTGACTTGACCGACTACCT
q-PV-ACT-R: CGAGAGCGACATAGCAGAGT
Figure 8 shows the relative expression levels of the target gene in Plagiodera versicolora . It can be observed that the transcription of the relevant gene was significantly downregulated after feeding with the dsRNA producing by Pseudomonas chlororaphis. The result suggests RNAi is working.