Best New Basic Part
Registry: pSB1C30YIpHR-HO/BBa_K4706000
Intoduction
As most plasmid backbones in the registery for S. cerevisiae are not well characterized we decided to document our backbone for further use. For more details visit our engineering page.
Design
pSB1C30YIpHR-HO is based of pSB1C30, it houses the HO locus homology sequences from ScHR3p-HO/BBa_J435241 and ScHR5p-HO/BBa_J435242 to facilitate stable genome integration adjacent to the S. cerevisiae HO locus.
The primers needed to linearize the vector for S. cerevisiae insertion are:
fwd: tctaattgtatcgagatcacttttcgtgatccg
rev: GGCAGAACTAACTCTTTATTTTTCCAAATCAGAAAA
Yeast Integrating plasmids (YIp) are non autonomously replicating plasmids that do not contain an ORI or similar replication modes like CEN/ARS containing plasmids that transform the DNA by homologous recombination. Once integrated into the genome, those strains are usually relatively stable.1 2 As it has been shown that linear DNA fragments have a much higher recombination frequency than circular plasmids, we decided that we wanted to linearize our backbone via PCR in our design, but preferrably without restriction enzymes, as to not degrade potential cloning capabilities of the backbone.3
We further decided to use NEBuilder to facilitate scarless integration of the homology sites into the vector.4 The main reason for not using the already existing cloning site of pSB1C30 was to avoid occupying it for genes of interests - this allows the user to utilize the BioBrick site for inclusion of their desired part.
Building a custom S. cerevisae YIp (HO5')
As we were conducting homology based cloning, linearizing pSB1C30 and ScHR5p-HO/BBa_J435242 was necessary first and foremost.
Each of the two fragments has a 40bp homology to the respective other and was assembled as previously shown via homology based cloning (NEBuilder).
This is the resulting intermediate plasmid:
After yielding transformants, we performed a PCR to confirm that our insert was present. We also loaded the plasmid itself onto a gel to confirm approximate total size via gel electrophoresis.
Gel electrophoresis of PCR and insert check. In our internal documentation we referred to pSB1C30YIpHR-HO5' as CD006.
We also obtained sequencing data which further confirmed that our insert was successful:
Sequencing results in PDF format are available in the references.5
Building a custom S. cerevisiae YIp (HO5' + HO3')
As we were conducting homology based cloning, we again needed to linearize our intermediate plasmid and ScHR3p-HO/BBa_J435241.
Each of the two fragments has a 40bp homology to the respective other and was assembled as previously described via homology based cloning (NEBuilder).
This is the resulting intermediate plasmid:
After yielding transformants we performed a PCR to confirm that our insert was present. We also loaded the plasmid itself on the gel to confirm approximate total size.
Gel electrophoresis of PCR and insert check. In our internal documentation we referred to pSB1C30YIpHR-HO as CD007.
Sequencing results in PDF format are available in the references6.
Test of custom S. cerevisae pSB1C30YIpHR-HO
We transformed what we thought at the time was the composite part BBa_K4706015/SrpR repressable PHO5 phosphate dependent cell death. Analysis of the assembly later revealed that we did not have a correct assembly. The linear DNA we transformed looked like this:
While this fragment entails the correct DNA sequence required for homology directed genomic DNA insertion, it contains no selective marker. As we prepared the uracil deficiency selective media, a mistake in the media preparation process took place. Uracil might have been accidentally added or was already present in our premix. The latter is more likely as we duplicated the transformation process. This time, no S. cerevisiae without the selective marker present grew on those plates.
We performed a colony PCR on the colonies grown in the transformation on non selecting plates, then searched for an insert flanked by BioBrick sites, which would look like this:
At first glance, it seems like the colony PCR results mostly in background noise, indicated by the insert bands being barely visible (we expected major intensity around 1kb), another possibility would be nonspecific amplification of our introduced insert. This would better explain why we still had 4 colonies without any amplification.
For this reason we also performed a reference colony PCR with 28 different colonies of S. cerevisiae BY4741 using the exact same protocoll and parameters to account for background amplifications of the S. cerevisiae genome. To our surprise, no background amplicons were present which suggests that the primers bound nonspecific to our introduced insert fragment.
This result suggests that our linear DNA, which was amplified from our backbone, has a suprisingly high transformation frequency. Out of 28 screened colonies we only observed four (4) colonies that tested negative on the insert. This would result in an approximate transformation frequency of 85.7%. We would have conducted additional tests but due to time and resource constraints we were not able to do so.
Parent, S.A., Fenimore, C.M. and Bostian, K.A. (1985), Vector systems for the expression, analysis and cloning of DNA sequence in S. cerevisiae. Yeast, 1: 83-138. https://doi.org/10.1002/yea.320010202↩
Hinnen, A., Hicks, J. B. and Fink, G. R. (1978). Transformation of yeast. Proceedings of the National Academy of Sciences U.S.A.75,1929↩
Orr-Weaver, T. L.; Szostak, J. W.; Rothstein, R. J. (1981). Yeast transformation: a model system for the study of recombination.. Proceedings of the National Academy of Sciences, 78(10), 6354–6358. doi:10.1073/pnas.78.10.6354 ↩
https://www.neb.com/en/applications/cloning-and-synthetic-biology/dna-assembly-and-cloning/nebuilder-hifi-dna-assembly↩