Parts and Materials Registry

Table 1: Bacterial Strains Utilised

Strain Name	Description	Source
E. coli TB18	E. coli T-B18 is a genetically engineered, adaptively evolved strain used in recent methylotrophy studies Has frmA gene knocked out Has pETM6_Ptrc_BsMdh_BmHps_BmPhi plasmid introduced	https://www.addgene.org/159446/
E. coli DH5α	E. coli DH5α is an expression strain for propagating plasmids.	https://www.neb.com/en/products/c2987-neb-5-alpha-competent-e-coli-high-efficiency#Product%20Information

Table 2: Vectors used in cloning and CRISPR-Cas9 Knockout

Vector Name	Description	Source
pETM6	pETM6_Ptrc_BsMdh_BmHps_BmPhi (pETM6) expresses genes (Mdh, Hps, and Phi) conducive for methylotrophy.	https://www.addgene.org/129104
pTargetF	Contains the sgRNA sequence complimentary to the desired 5’-NGG-3’ site for knockout.	https://www.addgene.org/62226
pCas9	Contains genes encoding the Cas9 complex necessary for performing CRISPR-Cas9 knockouts	https://www.addgene.org/42876
Circularized donor DNA	Composed of the upstream and downstream homology arms to T-B18’s tpiA gene. Replaces tpiA via homology-directed repair.	[N/A]

Table 3: Oligos used in cloning and CRISPR-Cas9

Oligo name	5' - 3' sequence	Purpose
pCas9_Cas9_F	CTCAATAGGCTTAGATATCGGCAC	Forward primer used to sequence the Cas9 gene in pCas9.
pCas9_Cas9_R	CTTCAGTCACCTCCTAGCTGAC	Reverse primer used to sequence the Cas9 gene in pCas9.
pCas9_CmR_F	GGAGCTAAGGAAGCTAAAATGG	Used to sequence the chloramphenicol resistance cassette in pCas9.
sgRNA_F	CAAGTGATCATTCAGTACGTTTTTTTGAATTCTCTAGAGTCGACCTGCAGAAGCT	Forward primer used for inverse PCR of pTargetF to insert desired sgRNA sequence
sgRNA_R	GTACTGAATGATCACTTGGCACCGACTCGGTGCCACTTTTTC	Reverse primer used for inverse PCR of pTargetF to insert desired sgRNA sequence.
ΔtpiA_cPCR_F	CTGTATAAAAACGTCGAAGTTCTGGATTCTGGC	Forward colony PCR primer used for verification of tpiA knockout.
ΔtpiA_cPCR_R	GTGCCAACAAACGCACCAAGATCGATAA	Reverse colony PCR primer used for verification of tpiA knockout.
sgRNA_F frdA	CGATGAACTCTGGGTTCAGGCC	Forward primer to insert 20 bp of sgRNA of frdA into pTargetF.
sgRNA_R frdA	CGTGTCTCAAACGGGACCAAATGAATATCGG	Reverse primer to insert 20 bp of sgRNA of frdA into pTargetF.

The two gRNA primers were obtained by introducing 20 bp of sgRNA within the tpiA genome that guides the Cas9 protein to cut and create strand breaks.The 20bp of sgRNA was generated using CHOPCHOP and analyzed based on various factors such as GC content, self-complementarity and efficiency. Collectively, they will amplify the backbone of pTargetF along with targeted tpiA sgRNA sequence to generalize linear PCR fragments, products will be transformed into E.coli later and self-circulaized in T-B18.

The tpiA Donor DNA is 1000 bp of synthesized double strand DNA that has 500 bp homologous to both upstream and downstream of tpiA gene region in T-B18 genome. Served as repair template for homologous recombination after Cas9 endonucleases cut at frdA region to knockout tpiA gene.

Both tpiA colony PCR primers were acquired by designing primers that are complementary to 500bp both upstream and downstream of the tpiA gene in E.coli genome. We will use these two parts to test the knockout results of the tpiA gene; if the products are longer than 1000bp, the tpiA is not knocked out successfully. If the amplified products are 1000bp, the tpiA gene is knockout successfully.

Both frdA gRNA primers were obtained by introducing 20 bp of sgRNA within the tpiA genome that guides the Cas9 protein to cut and create strand breaks.The 20bp of sgRNA was generated using CHOPCHOP and analyzed based on various factors such as GC content, self-complementarity and efficiency. This part will amplify the backbone of pTargetF along with targeted frdA sgRNA sequence to generalize linear PCR fragments, products will be transformed into E.coli later and self-circulaized in T-B18.

Table 4: Apparatus used in Rational Design.

Name	Purpose
ICS5000 (HPLC machine)	Used to run HPLC on bacterial samples grown overnight in methanol-containing minimal media to measure consumption.
GC Machine	Used as an alternative quantification apparatus to the ICS5000. Used to run gas chromatography on bacterial samples grown overnight in methanol-containing minimal media to measure consumption.