"The great book of nature is open before your eyes. It is only by studying its pages that you can hope to understand the secrets of the universe." - Galileo Galilei

introduction

Our biological experiments involve cycles of library creation and model validation in order to advance our understanding of various biological processes and to improve our model. During our experiments we created a simple and easy to follow protocol for replacing the origin of replication, we optimized the way of measuring the copy number and tested the effects of the plasmid copy number on different variables. In this page we present our wet lab research, the experiments we carried out, and the methods we used in a clear and detailed way.

Restriction digestion and ligation


In order to insert the chromoproteins from the iGEM part collection into a standard puc19 plasmid, we used restriction enzymes digestion and then ligation with T4 enzyme. To exaim which on of the chromoproteins from the iGEM part collection, is showing the strongest color in our system we checked 13 chromoproteins.


The protocols

Restriction protocol
Restriction Enzyme 10 units is sufficient, generally 1µl is used
DNA 1 µg
10X CutSmart 5 µl (1X)
Total Reaction Volume 50 µl

1. Prepare the reaction solution with: 1 µg DNA,5 µl 10X NEBuffer, 1 µl of each restriction enzyme, and complete to the total reaction volume of 50 µl with nuclease-free water.
2. Incubate for 1 hour in the enzyme-dependent incubation temperature.
3. Inactivate the enzymes using their inactivation temperature


Ligation protocol
T4 DNA Ligase Buffer (10X) 2 μl
Vector DNA (4 kb) 50 ng
Insert DNA (1 kb) 37.5 ng
T4 DNA Ligase 1 µl
Total Reaction Volume 20 µl

1. Set up the following reaction on ice: 2 µl of 10X T4 DNA Ligase Reaction Buffer, 50 ng vector DNA, 90 ng insert DNA, 1 µl immobilized T4 DNA Ligase and complete to the total reaction volume of 20 µl with nuclease-free water.
2. Incubate at 25°C for 30 minutes.

picture-1-exp

Replacing the origin of replication

To validate our model predictions and to gather new data we created a simple, easy to follow and an efficient protocol for replacing the origin of replication of a pUC19 plasmid with a modified one.

list of the new ORI segments
Name of sequence RANp sequence RNAi sequence
mut1 TTGACCTCCTTTTTTTCTGCGCGTAAGCTGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut2 TTGTCCTCCTTTTTTTCTGCGCGTAAGCTGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut3 TTTACCTCCTTTTTTTCTGCGCGTATGCTGCTGCTT TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut4 TTTACCTCCTTTTTTTCTGCGCGTATGTTGCTGCTT TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut5 TTTAAATCCTTTTTTTCTGCGCGTAAAATGCTGCTT TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut6 TTTAACTCCTTTTTTTCTGCGCGTAAGATGCTGCTC TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut7 TTT-GCTCCTTTTTTTCTGCGCGTAAGATGCTGCTC TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut8 TTTAACTCCTTTTTTTCTGCGCGTAAGATGCTGCTC GTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut9 TTTAACTCCTTTTTTTCTGCGCGTAAGATGCTGCTC TTGAAGTGGTGGCCTAACTACGGGCTACACTAGAAGA
mut10 TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTT TTTAAATGGTGGCCTAACTACGGCTATAATAGAAGAA
mut11 TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTT TTTCCATGGTGGCCTAACTACGGCTAAGATAGAAGTA
mut12 TTGTGATCCTTTTTTTCTGCGCGTAACATGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut13 TTTAAGTCCTTTTTTTCTGCGCGTAAAATGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut14 TTTAGCTCCTTTTTTTCTGCGCGTATAATGCTGCTG TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut15 TTTTCATCCTTTTTTTCTGCGCGTAAGATGCTGCTG TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
mut16 TTTACATCCTTTTTTTCTGCGCGTTAAATGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA

Further sequences that we generated but couldn't integrate into the plasmid:

RANp sequence RNAi sequence
TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTT TTGCCATGGTGGCCTAACTACGGCTATAATAGAAGA
TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTT TTTACATGGTGGCCTAACTACGGCTTAAATAGAAGT
TTGAATTCCTTTTTTTCTGCGCGTTAACTGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
TTGCTTTCCTTTTTTTCTGCGCGTACCATGCTGCTT TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
TTGACATCCTTTTTTTCTGCGCGTGCATTGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
TTTACATCCTTTTTTTCTGCGCGTCGTATGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
TTGTCATCCTTTTTTTCTGCGCGTAAGATGCTGCTA TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
TTTAAGTCCTTTTTTTCTGCGCGTCTGTTGCTGCTC TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
TTACGGTCCTTTTTTTCTGCGCGTGAATTGCTGCTC TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA
TTGAGTTCCTTTTTTTCTGCGCGTCCCCTGCTGCTT TTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA


We can hypothesize that these sequences probably produce a defective ORI and do not make a normal plasmid with good replicative ability.

Work Flow

1. A modified origin of replication is synthesized based on the tool’s output.
2. pUC19 is amplified using PCR to introduce new flanking regions around the ORI.
3. A restriction enzyme is employed to specifically target a cut site in the original pUC19.
4. The modified origin of replication is inserted using homologues joining to the pUC19 backbone.
5. Modified pUC19 vectors are transformed successfully, while the original vector doesn’t.

picture-2-exp


PCR

We used the PCR method to expand the backbone segments of the plasmid.

The protocol

1. place all reaction components on ice.
2. pick a colony and mix in 10 µl DDW.
3. prepare the reaction mix with: 5µl Taq polymerase, 2.5µl of each primer and 19 µl DDW.
4. aliquot 49 μl of the reaction mix into PCR tube.
5. add 1 μL of the colony sample.
6. run samples in the instrument.


Agarose gel electrophoresis

Using an agarose gel electrophoresis, we could check if the PCR samples contained DNA of the desired size, and we could continue to the next step of the protocol.

The protocol

1. Measure 1 g of agarose.
2. Mix agarose powder with 100 mL 1xTBE in a microwavable flask.
3. Microwave for 1.5 min until the agarose is completely dissolved.
4. Let agarose solution cool down for 5 minutes.
5. Add 5 μL ethidium bromide (EtBr).
6. Pour the agarose into a gel tray with the well comb in place.
7. Let the gel sit at room temperature for 20-30 mins, until it has completely solidified.
8. Add a loading buffer to each of your DNA samples.
9. Place the agarose gel into gel box filled with TBE.
10. Load 5 μL of a molecular weight ladder into the first lane of the gel.
11. Load 5 μL of the samples into the additional wells of the gel.
12. Run the gel at 120 V for approximately an hour.
13. Visualize the DNA fragments using UV-light.


picture-3-exp


Nebuilder assembly

The modified origin of replication was inserted using homologues joining with NEBuilder HiFi DNA Assembly cloning kit. The primers were built based on the NEBuilder web tool.To achieve optimal assembly efficiency, we designed 15-20 bp overlap regions between each fragment.

The protocol

1. Set up the following reaction on ice: 10 µl of NEBuilder HiFi DNA Assembly Master Mix, 50 ng vector DNA and 90 ng insert DNA e and complete to the total reaction volume of 20 µl with nuclease-free water.
2. Incubate samples in a thermocycler at 50°C for 15 minutes
3. transform 2 µl of the chilled assembled product to E-coli competent cells.


Chemical transformation

In our experiments we employed ColE1 plasmids and introduced them into E. coli DH5 alpha through a chemical transformation.

The protocol

1. Transfer 2 µl of the plasmid solution to competent bacteria and pipette well.
2. Keep the bacteria in -20 C° for 10 minutes.
3. Transfer the bacteria to 42 C° for 2 minutes.
4. Seed the bacteria on LB plate with a suitable antibiotic.
5. Incubate the plate at 37 C° overnight.

picture-4-exp

qPCR


Measuring plasmid copy number using colony qPCR is a powerful technique in molecular biology. It allowed us to assess how many copies of a specific plasmid are present within an individual bacterial colony while avoiding the experimental errors from DNA isolation (1).All qPCR reactions were performed in technical replicates on an applied biosystems Real-Time PCR Detection instrument using the following cycling conditions for all reactions: 95 °C for 10 min, and 40 cycles of 3 sec at 95°C and 30 sec at 60 °C. Primer specificity and efficiency were tested with melt-curve analysis and found to be good.


Our primers
Target Primer Sequence Position Length Melting temperature (Tm)
Plasmid F’- cgtgtcgcccttattccctt ampicillin resistance 20 bp 56.5 C°
Plasmid R’- cccaactgatcttcagca ampicillin resistance 18 bp 50.9 C°
Chromosome F’-cgagaaactggcgatcctta E. coli dxs gene 20 bp 60 C°
Chromosome R’-cttcatcaagcggtttacac E. coli dxs gene 20 bp 60 C°


The primers melt curve:
picture-5-exp


The protocol

1. place all reaction components on ice.
2. pick a colony and mix in 10 µl DDW, and dilute to the proper dilution (in our experiments 10^-6 was enough).
3. prepare the reaction mix with: 10µl fast SYBR Green Master Mix, 2µl of each primer and 5 µl DDW.
4.aliquot 19 μl of the reaction mix into each qPCR plate.
5. add 1 μL of the colony sample.
6. seal the PCR plate and spin down for 1 minute at 800 rpm.
7. run samples in the instrument.

Standard curve and PCN calculations

Creating a standard curve in qPCR is important for quantification and accurate measurement of target DNA. The standard curve allows the determination of the relationship between the cycle threshold (Ct) values and the initial concentration of the target DNA. By finding the amplification efficiency (E) we could calculate the plasmid copy number based on the following equations (2):

picture-6-exp


The protocol

1. prepare a series of DNA concentrations.
2. Perform qPCR analysis.
3. Plot the Ct values against the logarithm of the DNA concentrations.
4. Based on the slope of this curve, calculate the amplification efficiency of the chromosomal gene.
5. calculate the plasmid copy number.

picture-7-exp picture-8-exp

Growth experiment

In order to evaluate the effects of the different plasmids on the growth rate of the bacteria, we performed growth experiments by measuring their OD using a plate reader.


picture-9-exp

The protocol

1. prepare an overnight culture of each strain.
2. Adjust the wavelength of the spectrophotometer to 600 nm.
3. Blank the spectrophotometer with LB cuvette.
4. Measure the samples OD and dilute them to the same starting point.
5. Prepared additional dilution of 1:10 using LB.
6.Place the samples in a 96-well plate.
7. Place The plate in a preheated plate reader set at 37 C°.
8. Measure the absorbance at a wavelength of 600nm every 15 minutes over a duration of 16 hours.

LB preparation protocol

1. Add 1 liter of water to 20 gr of LB powder.
2. Autoclave.
3. After the solution has cooled to 60 °C, add antibiotics in a 1:1000 ratio.

LB agar plates preparation protocol

1. Add 1 liter of water to 20 gr of LB powder and 20 gr of agar.
2. Add stirrer and autoclave.
3. After the liquid has cooled to 60 °C, add antibiotics in a 1:1000 ratio.
4. Light a flame and pour the solution to the plates.

Patch plating protocol

1. Use a sterile toothpick to lift off a bacterial colony.
2. Transfer it to the surface of a fresh agar plate.
3. Incubate the plate at 37 C° overnight.

Starter Culture protocol

1. Use a sterile toothpick to lift off a bacterial colony.
2. Insert to a starter culture with 3 to 5 ml of media.
3. Incubate at 37 °C while shaking at 250-300 rpm overnight.

NucleoSpin® Plasmid EasyPure protoco for plasmid purification

1. Pellet cells into a microcentrifuge tube and discard supernatant.
2. Add 150 μL Buffer A1 and vortex to resuspend cells completely.
3. Add 250 μL Buffer A2 and invert 5 times – DO NOT VORTEX!
4. Incubate up to 2 min at room temperature to lyse cells.
5. Add 350 μL Buffer A3 and invert until lysate has turned colorless.
6. Centrifuge for 3 min at full speed (> 12,000 x g) to pellet precipitate.
7. Put a NucleoSpin® Plasmid EasyPure Column into a Collection Tube (2 mL).
8. Load clear supernatant onto the spin column.
9. Centrifuge for 30 s at 1,000–2,000 x g and discard flow-through.
10. Add 450 μL Buffer AQ to the spin column.
11. Centrifuge for 1 min at full speed (> 12,000 x g) and discard collection tube. REPEAT IF SPIN COLUMN IS STILL WET!
12. Put spin column into a new 1.5 mL microcentrifuge tube (not provided).
13. Add 50 μL Buffer AE onto the membrane and incubate for 1 min.
14. Centrifuge for 1 min at full speed (> 12,000 x g).

NanoDrop measurement protocol

1. Blank the NanoDrop using nuclease-free water.
2. Place 2µL of prepped DNA onto the pedestal.
3. Close the lid and click measure. purity is measured under the 260/280 column (A good purity ranges from 1.80-2.00).
4. Repeat for each sample.

Creating Bacterial Glycerol Stocks

1. prepare Starter Culture.
2. centrifuge for 10 minutes at 4,000 rpm.
3. pour out the supernatant.
4. resuspend the pellet in 30% glycerol.
5. freeze the glycerol stock tube at -80°C.
6. to recover bacteria from the glycerol stock, use a toothpick to scrape some of the frozen bacteria off of the top.

Electric transformation protocol

1. Keep the bacteria in -20 C° for 10 minutes.
2. Transfer 5 µl of the plasmid solution to competent bacteria and pipette well.
3. Transfer the bacteria to an electroporation cuvette.
4. Use an electroporator to expose competent cells and DNA to a brief pulse of a high-voltage electric field.
5. transfer the bacteria to 1 ml of LB.
6. Incubate at 37 C° for 1 hour.
7. Centrifuge for 2 minutes (in pull down).
8. Remove supernatant, add 1 ml DDW and pipette well.
9. Seed the bacteria on the LB plate with a suitable antibiotic.
10. Incubate the plate at 37 C° overnight.

References:

1. Wein, Tanita, et al. "Emergence of plasmid stability under non-selective conditions maintains antibiotic resistance." Nature communications 10.1 (2019): 2595.
2. Škulj, Mihaela, et al. "Improved determination of plasmid copy number using quantitative real-time PCR for monitoring fermentation processes." Microbial cell factories 7.1 (2008): 1-12.