Protocol Overview

1. pET-28a(+)-FGF2-G3fi with XbaI and XhoI

1a. Restriction Enzyme Digestion of pET-28a(+)-FGF2-G3fi with XbaI and XhoI

You need a linearized backbone for cloning of the insert via Gibson assembly. pET-28a(+)-FGF2-G3fi is the name of the plasmid that you are going to use as the backbone. pET-28a(+)-FGF2-G3fi has a multiple cloning site containing XbaI and XhoI restriction sites and in between you will clone the codon optimized human alpha amylase sequence.

Figure 1: Sequence for Plasmid Backbone (pET-28a(+)-FGF2-G3fi with XbaI and XhoI)

1b. Gel Extraction

If FGF2 transgene is there, you should see two bands following restriction enzyme digestion. You need the one with a bigger size, backbone, which is around 5 kbps. You should extract DNA from the band giving the desired signal. You should measure the concentration, A260/280 and A260/230 values and keep a record of those.

Figure 2: Expected Results after Restriction Digest

2. Alpha Amylase

3. Assembly

4. Transform Assembly

Transform the assembly product into DH5a by following the transformation protocol

5. Growth of Clones

Grow clones on selective agar plates with antibiotic and selection of some successful clones for verification

+ You can take -80 o C stocks at this stage to have backups of successful clones.

6. Plasmid Isolation

Following the instructions of QIAprep Spin Miniprep Kit

7. Verification of Cloning

You should verify the cloning by demonstrating the presence of insert in the plasmid. For this verification, there are several strategies:

• Restriction enzyme digestion (i.e. novel restriction enzyme in the insert, size change in the linearized plasmid)
• PCR (a primer pair flanking multiple cloning site, one primer attaches to the insert and the other attaches to the backbone)
• DNA sequencing

You will verify the cloning via PCR amplification. Forward primer was designed to attach the insert while the reverse primer attaches to the backbone. Amplification of a 213 bp-long amplicon indicates the presence of insert on the vector.

verification_fwd:5’ GTTAGCGATGATGGTAAAGC 3’

verification_rev: 5’ CCTCAAGACCCGTTTAGAG 3’

You can also verify successful insertion nucleotide by nucleotide via Next Generation Sequencing (NGS) to track point mutations if necessary.

8. Verification of Transformation (Colony PCR)

You can directly use colony plaques in PCR to verify the presence of plasmid in the clones. You should prepare the PCR master mix by adding the primers above (verification_fwd & verification_rev). You should first choose and mark the colonies (You will need the successful clones later). You should transfer cells from each colony to a PCR tube using a sterile micropipette tip or a sterile toothpick and briefly stir to resuspend them in the PCR master mix. Expected band size is ~200 bps.

9. Transformation into BL21

You should transform verified plasmid into the bacterial strain named BL21 for protein expression. After transformation, successful clones should be grown in LB overnight. Please do not forget to take cell stocks from the culture to have backups of the clones.

Our Findings

As our team is fighting to lower the cost of medicine, we will utilize an expressed, synthetic alpha amylase protein from the BL21 cells, and then we can detect them by both western blot and aptamers. The western blot is the basis of an ELISA, a tried and true method. This would be our fallback to detecting our synthetic protein. Our preference is to build a new diagnostic device where synthetic aptamers containing a 5' fluorescent tag become bound to AA protein (Minagawa et al., 2017). We then used a plate reader and emission spectra to determine bound vs unbound/free alpha amylase (Weaver and Whelan, 2020). The more bound signal, the more aptamer-protein complexes, the larger the fluorescent signal. Should this high signal persist over time with multiple buccal swabs, this is the points we would collect to determine when patients are experiencing acute stress and we would have a novel biomarker for acute stress. Our negative control for the aptamer experiments would have been thrombin and DNA strands specific to thrombin (Liu et al., 2020). A second method to detect the alpha-amylase-aptamer complex would have been through use of an EMSA where the binding of the probe greatly reduces the migration of the protein through an acrylamide gel. We could have expanded upon the use of an aptamer based approach and included cortisol as well (Strahler et al., 2017).

The use of an ELISA, fluorescent aptamers and an EMSA would have been three methods to prove our ability to detect an acute stress biomarker with alpha amylase for our novel diagnostic device. As our iGEM wiki freezes on October 12th, we will continue to develop our aptamer research to present conclusive research in Paris.

References

Minagawa, Hirotaka et al. “Selection, Characterization and Application of Artificial DNA Aptamer Containing Appended Bases with Sub-nanomolar Affinity for a Salivary Biomarker.” Scientific reports vol. 7 42716. 3 Mar. 2017, doi:10.1038/srep42716

Weaver, Simon D., and Rebecca J. Whelan. “Characterization of DNA Aptamer–Protein Binding Using Fluorescence Anisotropy Assays in Low-Volume, High-Efficiency Plates.” Analytical Methods, The Royal Society of Chemistry, 3 Feb. 2021, pubs.rsc.org/en/content/articlelanding/2021/ay/d0ay02256j.

“Gel Shift Assays (EMSA): Thermo Fisher Scientific - US.” Gel Shift Assays (EMSA) | Thermo Fisher Scientific - US, www.thermofisher.com/us/en/home/life-science/protein-biology/protein-biology-learning-center/protein-biology-resource-library/pierce-protein-methods/gel-shift-assays-emsa.html#1. Accessed 12 Oct. 2023.

Strahler, Jana et al. “Simultaneous measurement of salivary cortisol and alpha-amylase: Application and recommendations.” Neuroscience and biobehavioral reviews vol. 83 (2017): 657-677. doi:10.1016/j.neubiorev.2017.08.015

Liu, Qingxiu, et al. “Selex Tool: A Novel and Convenient Gel-Based Diffusion Method for Monitoring of Aptamer-Target Binding - Journal of Biological Engineering.” BioMed Central, BioMed Central, 13 Jan. 2020, jbioleng.biomedcentral.com/articles/10.1186/s13036-019-0223-y.