Proof of Concept

Overview

The main objective of the proof of concept is to demonstrate whether or not our project is feasible. We synthetically designed short sequences (mimicking the viral mRNA) that we attempt to detect with our system based on Cas13. To achieve this purpose, numerous steps were required, which are presented below.

NCBI Search : Sequence Retrieval and Evaluation

The focus of our project is the West Nile Virus (WNV). The sequences were retrieved from the viral genome section of the National Center for Biotechnology Information (NCBI).

On those sequences, a BLAST (Basic Local Alignment Search Tool) was performed, with a maximum target sequence limit at 5 000 (the maximum possible). By fine tuning the parameters “Percent Identity” and “Query Coverage" with values respectively between 85-100 and 95-100, we were able to exclude most of the sequences non-related to WNV.

Partial genome and coding sequences were also excluded from the analysis, leading to a dataset of 223 sequences. Those were then downloaded as fasta files.

Multiple Sequence Alignment

The fasta sequences above were subjected to multiple sequence alignment, using the MAFFT tool. The resulting alignment was saved in the Clustal format. In order to visualize the alignment and color the sequences with 100% identity, the Jalview website was used.

The sequences of interest were selected based on a length criterion. The minimum of 25 nucleotides is required, although 28 nucleotides are recommended (28+ nucleotides were used for our project).

The following target sequences were obtained for the WNV, derived from the 223 sequences:

Fig 1.1 : First target sequence of the WNV (34 nt): CTCTCGGATTCCTCAATGAAGACCACTGGCTGGG
Fig 1.2 : Second target sequence of the WNV (29 nt): AAGACACCAGAAGGAGAAATTGGGGCAGT

First conserved sequence : Code for a catalytic core domain of Flavivirus RdRp (RNA dependent RNA polymerase).
It make sense that it is relatively conserved as RdRp is responsible of RNA replication of viruses.

Second conserved sequence : Code for a peptidase S7 : NS3 serine protease. Flavivirus like WNV virus encodes
only one polyprotein precursor. This precursor will be able to form mature protein under the action of the complex
NS2B-NS3. Therefore it make sense that this particular sequence is conserved among variants of WNV as it is resposible of proteins production.= https://www.ebi.ac.uk/interpro/entry/InterPro/IPR001850/

DNA Sequences Amplification

Once we identify the sequences to target, the aim was to synthetise them as well as guide RNA, we used Integrated DNA Technologies (IDT) for this. You may ask yourself why use DNA if we are studying RNA viruses. Well, the main reasons are :

  • DNA synthesis is cheaper
  • DNA is more stable than RNA
  • Easier Amplification (PCR vs RT-PCR)

    • Afterward, we employed PCR (Polymerase Chain Reaction) to increase yield of our target, and guide sequences. Different forward and reverse sets of primers were used for this purpose (see tables below) :

    Target :

    Fig 2 : Scheme of the primers we used to synthetize WNV target sequences

  • The forward primer starts with the enhancer, followed by the T7 promoter, an upstream sequence (-20 nucleotides
    before the target), 28 nucleotides of the actual target sequence, and finally a downstream region of the target site
    of 20 nucleotides. Those 20 nucleotides upsteam and downstream are used to keep the general spacial context of

  • The reverse primer is composed of the reverse complement of the +20 nucleotides sequence and the reverse
    complement of the 28 nucleotides to target.

    You will find below the target DNA sequence after amplification

    Tab 1.1 : Target DNA sequence obtained after PCR. The notation is as followed : T = Target , 1 = First conserved sequence, 2 = Second conserved sequence. Furthermore, the target sequence was shift from 2 nucleotides each time for primers T 1.1-1.4, and from 1 nucleotide for primers T 2.1-2.1, the aim being to see if their could be detection differences.

    Tab 1.2 : Primers used to synthetise our target DNA. The notation is as followed : P = primers, Fw = forward, Rw = Reverse, T = target. For the numbers attributed to the primers : 1 = First conserved sequence, 2 = Second conserved sequence.

    Guide :

    The synthesis of primers for the guides use the same principle as the target sequences. The difference is that the guide need to be able to hybridize with the 28 nucleotide sequence site of the target, also it contain a scaffold that is specific to the type of Cas used: CasRX or LwCas13a (see Fig 3).

    Fig 3: Scheme for the synthesis of LwCas13a and CasRX guides primers
    Tab 1.3: Table of the LwCas13a guide sequences

    Below is repertoried, the tables containing the sequences of our LwCas13a and CasRX guides.

    Tab 1.4: Table of the CasRX guide sequences
  • Forward primer composed of an enhancer, T7 promoter, and the stem loop of the Cas used (LwCas13a or RfxCas13d). This primer stay the same for all guide sequences of the same Cas.
  • Reverse primer consisted of the 28 nucleotides target sequence, accompanied by the reverse complement of the Cas stem loop. This primer change as it is specific to target sequence.

    • Transcription

    The sequences were transcribed through T7 transcription. It is a method used for rapidly making a lot of RNA copies using only a single piece of DNA. Accurate and efficient, it possesses the downside of being able to transcribe one sequence at a time, while other techniques are able to do multiple one simultaneously.

    The quality of the RNA was assessed using a nanodrop spectrophotometer. Another efficient way to measure RNA concentration, that was not available to us, is to use the Qubit technology. Considering the nanodrop as a tool to get a quick estimation of the concentration, in this way the Qubit is a tool giving an exact measurement. It’s a choice between the speed and the accuracy that must be done when measuring RNA.

    Cas Activity Assessment

    Verification of the LwCas13a enzyme functionality was made through a fluorescence detection assay, performed on a Cytation plate reader. Gel electrophoresis was deemed unsuitable, according to the low cutting efficiency, as the band cleavage would not have been observable on a gel. The results of the fluorescence detection are presented in the Results section.

    Further informations are available in the:

  • Engineering section for the designing of the sequences and experiments
  • Experiments section for the protocols and details about the experiments
  • Notebook section for the access to the lab notebook
  • Results section for the results and discussion
  • Perspective section for information about what can be done in future experiments and how the project can be applied outside of the lab

    • Validation

  • The results of these experiments serve as evidence of proof of concept of our project. This foundational work can lead to further investigations, including applications in mosquito and diseases control.
  • During this project, many results were achieved, including making chemically competent cells, transforming a plasmid in the so-said cells, making de novo sequences through primer amplification, with sequences that are able to proceed a transcription step and even work with enzymes to make fluorescent detections. More details can be found below, including the steps, the results and the discussion of everything that was completed.