| MIT_MAHE - iGEM 2023

Growth Curve

Week 1

Experiment 1: Revival of Pseudomonas putida culture

18/07/2023

Project: CarbanEl

Authors: Aditi Balasubramani

Pseudomonas putida culture:

The MTCC (Microbial Type Culture Collection and Gene Bank) number of the culture: 1072

A lyophilised culture that was stored in a glass ampoule was transferred into Nutrient broth media, distributed into test tubes, and incubated for further use at the required optimum temperature and time period as mentioned by the culture suppliers (for Pseudomonas putida, the incubation was done at 30°C for 24 hours).
The cultures were monitored to observe growth and detect signs of contamination.

Experiment 2: Inoculation and streak plating of the culture

09/08/2023

Project: CarbanEl

Authors: Aditi Balasubramani, Akanksha Kelkar

Pseudomonas putida culture:

1 ml of culture from one test tube was transferred into an Eppendorf tube to prevent contamination.
A heat-sterilized inoculation loop was dipped into the Eppendorf tube containing the culture. A Petri dish containing nutrient broth agar was taken and quadrant streaking was done.

Result:

The streaked plate was observed:

(Figure: A petri dish streaked with Pseudomonas putida.)

Experiment 3: Confirmatory tests for Pseudomonas putida

09/08/2023

Project: CarbanEl

Authors: Aditi Balasubramani, Akanksha Kelkar

Confirmatory tests for Pseudomonas putida

Confirmatory tests were performed to confirm the characteristics of the bacteria. These tests included a catalase test, a gram staining test, an indole spot test, and a MR-VP test.

Catalase test- Pseudomonas putida has the ability to produce catalase, and a positive catalase test indicates that the organism possesses this characteristic. When performed, the following result was obtained.

(Figure: Catalase positive reaction: Evident by immediate effervescence (bubble formation)

Gram staining- A Gram staining test was performed on the culture. The cells appeared pink when viewed under the microscope, confirming that they are Gram-negative (as expected, the shape was bacillus). (Figure: Microscopic view of a bacterial culture Gram stain - the cells appear as dark pink dots on a lighter pink background with a magnification of 100x)

Test	Expected Result	Observations	Results
Gram staining	Gram-negative	Cells appeared pink when viewed under a microscope	Cells were concluded to be Gram-negative
Catalase Test	Evidence of catalase production	Effervescence was observed	Cells were concluded to be producing catalase

Experiment 4: Primary inoculation for confirmatory tests for Pseudomonas putida

11/08/2023

Project: CarbanEl

Authors: Aditi Balasubramani, Akanksha Kelkar

Pseudomonas putida culture

Pseudomonas putida was inoculated in a test tube with LB broth and left overnight to be used for the indole spot confirmatory test. One of the prepared plates was used for subculturing.

Experiment 5: Primary inoculation for confirmatory tests for Pseudomonas putida

12/08/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica, Nidhi Mallya, Pooja Agarwal

Pseudomonas putida culture

The culture was observed to have been contaminated and was unsuitable for use in the indole spot confirmatory test. Another sample was incubated at 30°C, 180 rpm overnight.

Experiment 6: Confirmatory tests for P. putida (Indole Test)

11/08/2023

Project: CarbanEl

Authors: Aditi Balasubramani, Akanksha Kelkar

Pseudomonas putida culture

Confirmatory Test for Pseudomonas putida (Indole Test):

Indole test- The Indole spot test was performed with the inoculated culture. A piece of Whatman filter paper was placed in a petri dish cover and saturated with Kovács reagent. The paper was then smeared with cell paste from the culture. There was no visible colour change, indicating a negative result. The organism was confirmed to lack the ability to produce tryptophanase. (Figure: Indole negative test of Pseudomonas putida)
MRVP test preparation- To prepare for the Methyl Red and Voges-Proskauer test, MR-VP broth medium was prepared in three test tubes and autoclaved. Pseudomonas putida was inoculated into the appropriate tube, with the other tube serving as blank. All the test tubes were incubated at 37°C for 24 hours.

Test Expected Result Observations Results
Confirmatory test for Pseudomonas putida(MRVP):
Methyl red test- A Methyl Red Test was performed, and a negative result was obtained. This indicates that it does not produce organic acid end products following the metabolism of glucose, or acid end products are enzymatically converted into non-acidic compounds.This indicates that it does not produce organic acid end products, or acid end products are enzymatically converted into non-acidic compounds. Thus proving that Pseudomonas putida does not ferment glucose.
(Figure: Negative Methyl Red test)
Voges- Proskauer test- Voges- Proskauer test was performed and a negative result was obtained. This indicates the absence of non-acidic and neutral compounds being formed as end products following the metabolism of glucose. (Figure: Negative Voges- Proskauer test)

Tests	Expected Results	Observation	Conclusion
Methyl Red test	Negative result (Culture should remain yellow)	Negative results were observed	Cells produce stable non-acidic end products
Voges- Proskauer test	Negative result (No colour change in culture)	Negative results were observed	There is an absence of non-acidic and neutral compounds being formed as end products

Experiment 7: Growth curve for P. putida in presence of Acetonitrile

13/08/2023

Project: CarbanEl

Authors: Wet Lab team

**Growth curve of Pseudomonas putida in the presence of Acetonitrile**

This growth curve was necessary since, the growth curve in presence of TCC included addition of acetonitrile for dissolving, hence we needed to ensure that there is not any effect of acetonitrile on the growth.

Growth curves for Pseudomonas putida when in the presence of acetonitrile were prepared.
Three conical flasks were taken, and 25 ml LB broth was prepared in each and labelled Blank, Control and Culture + Acetonitrile, respectively and autoclaved.

Observation/OD at 600nm was measured at different time intervals as mentioned in the table below.

Time (hours)	Control	Acetonitrile
0	0.1	0.2
2	0.9	0.9
4	2.5	2.7
6 (diluted)	5 (0.5)	6 (0.6)
8 (diluted)	9 (0.9)	9 (0.9)
18 (diluted)	9 (0.9)	9 (0.9)

(dilution- 1/10th)

Result:It was found that the presence of acetonitrile doesn't affect the growth of Pseudomonas putida.

Week 2

Experiment 8: Growth curve for P. putida in presence of Acetonitrile

13/08/2023

Project: CarbanEl

Authors: Wet Lab team

**Growth curve for growth of Pseudomonas putida in the presence of acetonitrile**

Three test tubes, one blank, one a control, and one containing a mix of culture and 1% acetonitrile solution.

Observation/OD at 600nm was measured at different time intervals as mentioned in the table below.

Time (hours)	Control	Acetonitrile
0	0	0
2	0	0
4	0	0
6	0.2	0.2
8	1.9	1.8
10 (diluted)	6(0.6)	6(0.6)
12 (diluted)	7(0.6)	8(0.7)
14 (diluted)	9(0.9)	10(1.0)
24 (diluted)	7(0.7)	7(0.7)

(dilution- 1/10th)

Result: It was found that the presence of acetonitrile doesn't affect the growth of Pseudomonas putida.

Experiment 9: Growth curve for P. putida in presence of Acetonitrile

13/08/2023

Project: CarbanEl

Authors: Wet Lab team

**Growth curves for Pseudomonas putida in the presence of acetonitrile**

Three test tubes, one blank, one a control, and one containing a mix of culture and 1% acetonitrile solution, were taken and observed.

Observation/OD was measured at different time intervals as mentioned in the table below.

Time (hours)	Control	Acetonitrile
0	0	0
2	0.03	0.023
3	0.1	0.1
4	0.3	0.3
5	0.8	0.8
6	0.2	0.2
7 (diluted)	3(0.3)	3(0.3)
8 (diluted)	4(0.404)	4(0.4)
9 (diluted)	4.3(0.423)	4.3(0.430)
10 (diluted)	4.1(0.412)	4.4(0.441)
12 (diluted)	5.91(0.591)	6.19(0.619)

(dilution- 1/10th)

Result: It was confirmed that the presence of acetonitrile does not affect the growth of Pseudomonas putida. The sudden increase in the growth curve may be attributed to either contamination or the utilization of an alternative carbon source(Diauxic growth).

Experiment 10: Growth curve for P. putida at pH 8.0

16/08/2023

Project: CarbanEl

Authors: Wet Lab team

**Growth curve for Pseudomonas putida at pH 8.0**

Growth curves were prepared for Pseudomonas putida.
Four conical flasks were taken and labelled Flask 1, Flask 2, Flask 3, and Blank. The pH was adjusted using 1N NaOH and all flasks were autoclaved.
The flasks were observed for a time period of 12 hours.

Time (hours)	Flask 1	Flask 2	Flask 3
0	0	0	0
3	0.017	0.00	0.031
4	0.032	0.00	0.038
6.5	0.592	0.074	0.684
7.25	0.929	0.135	1.117
8.25	1.833	0.414	1.957
9.25 (diluted)	2.26 (0.026)	1.02 (0.102)	2.6 (0.26)
10.25 (diluted)	3.48(0.348)	2.23(0.223)	3.49(0.349)
11.25 (diluted)	3.91(0.391)	2.46(0.246)	4.05(0.405)
12 (diluted)	3.7(0.37)	2.5(0.25)	4.71(0.471)

(dilution- 1/10th)

Experiment 11: Growth curve for P. putida at pH 6.0 and 7.0

18/08/2023

Project: CarbanEl

Authors: Wet Lab team

**Growth curve for Pseudomonas putida at pH 6 and 7**

Growth curves were prepared for Pseudomonas putida.
Three conical flasks were taken and labelled Flask 1, Flask 2, and Blank. The pH was adjusted using 1N HCl and all flasks were autoclaved.
The flasks were observed over a time period of 12 hours.

At pH 6:

Time (hours)	Flask 1	Flask 2	Average
0	0	0	0
2	0.057	0.003	0.030
3	0.048	0.011	0.0295
4	0.108	0.057	0.0825
5	0.313	0.174	0.2435
6.5	1.034	0.66	0.847
8.25 (diluted)	2.16(0.216)	1.74(0.174)	1.95
9 (diluted)	2.88(0.288)	2.45(0.245)	2.665
10 (diluted)	3.83(0.383)	3.11(0.311)	3.47
11 (diluted)	4.63(0.463)	3.83(0.383)	4.23
12 (diluted)	5.39(0.539)	4.76(0.476)	5.075

At pH 7:

Time (hours)	Flask 1	Flask 2	Average
0	0	0	0
2	0.027	0.074	0.0505
3	0.013	0.074	0.0435
4	0.099	0.131	0.115
5	0.373	0.437	0.405
6.5	1.127	1.344	1.2355
8.25 (diluted)	2.13(0.213)	2.88(0.288)	2.505(0.2505)
9 (diluted)	2.83(0.283)	3.23(0.323)	3.03(0.303)
10 (diluted)	3.3(0.33)	3.38(0.338)	3.34(0.34)
11 (diluted)	4.62(0.462)	5.1(0.510)	4.86(0.486)
12 (diluted)	4.93(0.493)	5.32(0.532)	5.125(0.5125)

Comparisons were drawn between growth curves at different pH levels to determine the optimal pH for growth.

Result:The optimal pH for growth of Pseudomonas putida was observed to be pH 7.5/7.7.

Week 3

Experiment 12: Growth curve for P. putida at 24 and 37 degrees Celsius

21/08/2023

Project: CarbanEl

Authors: Wet Lab team

**The effect of temperature on the growth of Pseudomonas putida was studied:**

24°C

Time (hours)	Flask 1	Flask 2
1	0	0
2	0.9	0.9
3	0.306	0.082
4	0.493	0.165
5	1.331	0.409
6	2.291	0.939
7	2.75	1.5
8	3.33	2.42
11	10.42	9.76

37°C

Time (hours)	Flask 1	Flask 2
1	0	0.001
2	0	0.019
3	0	0.025
4	0	0.028
5	0.008	0.028
6	0.024	0.034
7	0	0.08
8	0.06	0.15
11	3.39	0.18

Comparisons were drawn between growth curves at different temperatures to determine the optimal temperature for growth.

Result:The abrupt surge in growth at 9th hour in flask 2 is likely due to contamination. It is observed that Pseudomonas putida exhibits superior growth at 24 degrees Celsius, whereas its growth is adversely affected at 37 degrees Celsius.

Experiment 13: Growth curve for P. putida at different concentrations of TCC

22/08/2023

Project: CarbanEl

Authors: Wet Lab team

**Growth curves for Pseudomonas putida at different concentrations of TCC**

2000ng/L

Time (hours)	Control	Flask 1	Flask 2	Average
0	0	0	0	0
1	0.074	0.005	0.026	0.0155
2	0.225	0.025	0.045	0.035
3	0.891	0.127	0.339	0.233
4	1.384	0.323	0.558	0.4405
6	2.22	1.817	2.41	2.1135
7	2.82	2.51	3.06	2.785
8	3.334	2.83	4.11	3.47
9	contaminated	4.7	4.55	4.625
10	contaminated	4.13	4.78	4.455

3000 ng/L

Time (hours)	Control	Flask 1	Flask 2	Average
0	0	0	0	0
1	0.074	0.011	0.26	0.0185
2	0.225	0.037	0.045	0.0405
3	0.891	0.178	0.207	0.1925
4	1.384	0.416	0.455	0.4355
6	2.22	1.997	2.04	2.0185
7	2.82	2.68	2.76	2.72
8	3.334	3.12	2.97	3.045
9	contaminated	3.6	3.23	3.415
10	contaminated	3.68	3.77	3.725

4000 ng/L

Time (hours)	Control	Flask 1	Flask 2	Average
0	0	0	0	0
1	0.074	0.005	0.012	0.0085
2	0.225	0.032	0.033	0.0325
3	0.891	0.162	0.203	0.1825
4	1.384	0.361	0.328	0.3445
6	2.22	2.007	1.921	1.964
7	2.82	2.69	2.7	2.695
8	3.334	3.37	2.71	3.04
9	contaminated	3.54	3.88	3.71
10	contaminated	3.77	3.95	3.86

Result: It was observed that Pseudomonas putida had a slower growth in the presence of TCC when compared to the control.

Experiment 14: Reviving of culture for P. fluorescens

23/08/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Another chassis, Pseudomonas fluorescens, was considered for our project. The culture was revived, and growth curves were prepared for it.

The MTCC (Microbial Type Culture Collection and Gene Bank) number of the culture: 6627

Pseudomonas fluorescens culture:

A lyophilised culture that was stored in a glass ampoule was transferred into growth media, distributed into test tubes, and incubated for further use in nutrient broth at the required optimum temperature and time period as mentioned by the culture suppliers (for Pseudomonas fluorescens, the incubation was done at 30°C for 24 hours).
The cultures were monitored to observe growth and detect signs of contamination.

Experiment 15: Inoculation and streak plating of the culture

24/08/2023

Project: CarbanEl

Authors: Akanksha Kelkar, Vidhula Jessica

Pseudomonas fluorescens culture

1 ml of culture from one test tube was transferred into an Eppendorf tube for testing.
A heat-sterilized inoculation loop was dipped into the Eppendorf tube containing the culture. A Petri dish containing nutrient broth agar was taken and quadrant streaking was done.

Experiment 16: Confirmatory tests for P. fluorescens

25/08/2023

Project: CarbanEl

Authors: Nidhi Mallya, Vidhula Jessica

Confirmatory tests for Pseudomonas fluorescens

Gram stain test- A Gram staining test was performed on the culture. The cells appeared pink when viewed under the microscope, confirming that they are Gram-negative.

(Figure: Microscopic view of a bacterial culture - the cells appear as dark pink dots on a lighter pink background at a magnification of 100x)
Indole spot test- The Indole spot test was performed with the inoculated culture. A piece of Whatman filter paper was placed in a petri dish cover and saturated with Kovács reagent. The paper was then smeared with cell paste from the culture.There was no visible colour change, indicating a negative result. The organism was confirmed to lack the ability to produce tryptophanase.

(Figure: Indole negative test of Pseudomonas fluorescens)
Voges- Proskauer test- This test was performed and a negative result was obtained. This indicates the absence of non-acidic and neutral compounds being formed as end products following metabolism of glucose.
Methyl red test- A Methyl Red Test was performed, and a negative result was obtained. This indicates that it does not produce organic acid end products, or acid end products are enzymatically converted into non-acidic compounds. This indicates that it does not produce organic acid end products, or acid end products are enzymatically converted into non-acidic compounds. Thus proving that Pseudomonas fluorescens does not ferment glucose.

(Figure: Two test tubes held up. The first one, labelled VP, has dark yellow liquid in it, indicating a negative result for the Voges Proskauer test. The second, labelled MR, has a light yellow liquid, indicating a negative result for the Methyl Red test)
Catalase Test- Pseudomonas fluorescens has the ability to produce catalase, and a positive catalase test indicates that the organism possesses this characteristic. When performed, we obtained positive results.

(Figure: A slide held up to show the presence of effervescence, confirming the production of catalase.)

Test	Expected Result	Observations	Results
Gram staining	Gram-negative	Cells appeared pink when viewed under a microscope	Cells were concluded to be Gram-negative
Indole test	Negative result (No visible colour change)	Negative results were observed	Cells lack the ability to produce tryptophanase
Methyl Red test	Negative result (Culture should remain yellow)	Negative results were observed	Cells produce stable non-acidic end products following metabolism of glucose
Voges-Proskauer test	Negative result (No colour change in culture)	Negative results were observed	There is an absence of non-acidic and neutral compounds being formed as end products
Catalase Test	Evidence of catalase production	Effervescence was observed	Cells were concluded to be producing catalase

Experiment 17: Growth curve of Pseudomonas fluorescens with Acetonitrile

26/08/2023

Project: CarbanEl

Authors: Wet Lab Team

**Growth curve for growth of Pseudomonas fluorescens in the presence of Acetonitrile**

Three test tubes, one blank, one a control, and one containing a mix of culture and 1% acetonitrile solution, were taken and observed.
Observation/OD was measured at different time intervals as mentioned in the table below.

Time (hours)	Acetonitrile-Flask 1	Acetonitrile-Flask 2
0	0	0
1	0.006	0.008
2	0.051	0.055
3	0.154	0.055
4	0.561	0.156
5	0.753	0.261
6	1.373	0.53
7	1.951	0.82
8	2.42	0.909
9	3.2	2.03
10	4.07	3.28

It was found that the presence of acetonitrile does not appreciably affect the growth of Pseudomonas fluorescens.

Week 4

Experiment 18: Growth curve of P. fluorescens at 24 and 30 degrees Celsius

27/08/2023

Project: CarbanEl

Authors: Wet Lab team

**The effect of temperature on the growth of Pseudomonas fluorescens was studied:**

24°C

Time (hours)	Flask 1	Flask 2
0	0	0
1	0	0.001
2	0.006	0.003
3	0.01	0.012
4	0.033	0.015
5	0.036	0.02
6	0.049	0.067
7	0.087	0.095
8	0.161	0.107
9	0.21	0.17
10	0.237	0.285
11	0.391	0.401

30°C

Time (hours)	Flask 1	Flask 2
0	0	0.001
1	0.001	0.002
2	0.009	0.002
3	0.013	0.042
4	0.038	0.049
5	0.049	0.061
7	0.056	0.066
8	0.102	0.093
9	0.162	0.22
10	1.51	1.557
11	2.223	2.29

Comparisons were drawn between growth curves at different temperatures to determine the optimal temperature for growth.

Result:It was observed that Pseudomonas fluorescens exhibits better growth performance at 30 degrees Celsius.

Experiment 19: Growth curve of P. fluorescens at ph 6.0, 7.0 and 8.0

29/08/2023

Project: CarbanEl

Authors: Wet Lab Team

**The effect of pH on the growth of Pseudomonas fluorescens was studied:**

Growth curves were prepared for Pseudomonas fluorescens.
Three conical flasks were taken and labelled Flask 1, Flask 2, and Blank.
The pH was adjusted using 1N NaOH and all flasks were autoclaved.
The pH was adjusted using 1N NaOH and all flasks were autoclaved.

At pH 6:

Time (hours)	Flask 1	Flask 2	Average
0	0	0	0
2	0	0.002	0.001
5	0.002	0.005	0.0035
6	0.047	0.016	0.0315
7	0.072	0.043	0.0575
10	0.086	0.059	0.0725
12	0.095	0.071	0.083

At pH 7:

Time (hours)	Flask 1	Flask 2	Average
0	0	0	0
2	0.083	0.002	0.0425
5	0.081	0.02	0.0505
6	0.061	0.011	0.036
7	0.14	0.066	0.103
10	0.408	0.415	0.4115
12	1.288	1.322	1.305

At pH 8:

Time (hours)	Flask 1	Flask 2	Average
0	0	0	0
2	0	0	0
5	0	0.041	0.0205
6	0.004	0.07	0.05
7	0.008	0.139	0.0735
10	0.488	0.88	0.684
12	1.361	2.062	1.7115

Comparisons were drawn between growth curves at different pH levels to determine the optimal pH for growth

Result: The optimal pH for growth of Pseudomonas fluorescens was observed to be pH 8.

Experiment 20: Growth curve of P. fluorescens for determining lag phase

30/08/2023

Project: CarbanEl

Authors: Wet Lab Team

**Determination of the lag phase of Pseudomonas fluorescens with two duplicates:**

Growth curves were prepared for Pseudomonas fluorescens.
Three conical flasks were taken and labelled Flask 1, Flask 2, and Blank.
The flasks were observed over a time period of 10 hours.

Time (hours)	Flask 1	Flask 2
0	0	0
1	0.006	0.008
2	0.051	0.055
3	0.154	0.055
4	0.561	0.156
5	0.753	0.261
6	1.373	0.53
7	1.951	0.82
8	2.42	0.909
9	3.2	2.03
10	4.07	3.28

Result: It was observed that the lag phase for Pseudomonas fluorescens extended for a duration of 5 hours before entering the exponential growth phase.

Experiment 21: Growth curve of P. putida at different concentrations of TCC

31/08/2023

Project: CarbanEl

Authors: Wet Lab Team

**The effect of various concentrations of TCC on the growth of Pseudomonas putida was observed**

13000ng/ml

Time (hours)	Control	Flask 1	Flask 2	Average
0	0	0	0	0
2	0.074	0	0.012	0.006
3	0.225	0	0.011	0.006
4	0.891	0	0.032	0.016
4	1.384	0.361	0.328	0.3445
5	1.384	0.019	0.115	0.067
6	2.22	0.045	0.207	0.126
7	2.282	0.088	0.417	0.253
8	3.334	0.266	0.713	0.49
9	3.5	0.645	1.342	0.994
10	3.7	2.178	2.581	2.38

17000ng/ml

Time (hours)	Control	Flask 1	Flask 2	Average
0	0	0	0	0
2	0.074	0.001	0	0
3	0.225	0.051	0	0.026
4	0.891	0.133	0.004	0.069
5	1.384	0.265	0.003	0.134
6	2.22	0.445	0.047	0.246
7	2.282	0.813	0.131	0.472
8	3.334	1.296	0.283	0.664
9	3.5	1.917	1.2	1.559

21000ng/ml

Time (hours)	Control	Flask 1	Flask 2	Average
0	0	0	0	0
2	0.074	0.002	0	0.001
3	0.225	0.023	0.067	0.045
4	0.891	0.034	0.078	0.056
5	1.384	0.094	0.254	0.174
6	2.22	0.19	0.444	0.317
7	2.282	0.374	0.696	0.535
8	3.334	0.645	1.198	0.922
9	3.5	1.094	1.672	1.383

Result: It was observed that the growth of Pseudomonas putida was affected in the presence of different TCC concentrations and was stunted as compared to control.

Experiment 22: Growth curve of P. fluorescens at different concentrations of TCC

01/09/2023

Project: CarbanEl

Authors: Wet Lab Team

**The effect of various concentrations of TCC on the growth of Pseudomonas fluorescens was observed**

13000ng/ml

Time (hours)	Flask 1	Flask 2	Average
0	0	0	0
1	0	0	0.
2	0.034	0.014	0.024
4	0	0.032	0.016
4	0.1	0.022	0.061
5	0.125	0.062	0.0935
6	0.215	0.115	0.165
7	0.426	0.26	0.343
8	0.654	0.406	0.53
9	1.024	0.761	0.8925
10	1.373	1.1	1.2365
21.5	6.45	4.22	5.335

17000ng/ml

Time (hours)	Flask 1	Flask 2	Average
0	0	0	0
1	0	0	0.
2	0.047	0.017	0.032
4	0.104	0.078	0.091
5	0.212	0.136	0.174
6	0.306	0.191	0.2485
7	0.563	0.438	0.5005
8	0.839	0.66	0.7495
9	1.293	1.024	1.1585
10	1.744	1.503	1.6235
21.5	4.99	5.33	5.16

21000ng/ml

Time (hours)	Flask 1	Flask 2	Average
0	0.007	0.019	0.013
1	0.02	0.023	0.0215
2	0.021	0.024	0.0225
4	0.049	0.043	0.046
5	0.094	0.186	0.14
6	0.138	0.281	0.2095
7	0.322	0.519	0.4205
8	0.528	0.834	0.681
9	0.844	1.189	1.0165
10	1.138	1.492	1.315
21.5	5.05	6.96	6.005

Result:It was observed that TCC did not deter the growth of Pseudomonas fluorescens.

Week 5

Experiment 23: Revival of Acinetobacter baylyi culture

10/09/2023

Project: CarbanEl

Authors: Wet Lab Team

Acinetobacter baylyi culture:

A culture that was stored in a glass ampoule was transferred into growth media, distributed into test tubes, and incubated for further use at the required optimum temperature and time period as mentioned by the culture suppliers. (30 °C for 24 hours).
The cultures were monitored to observe growth and detect signs of contamination.
1 ml of culture from one test tube was transferred into an Eppendorf tube for testing.
A heat-sterilized inoculation loop was dipped into the Eppendorf tube containing the culture. A Petri dish containing nutrient broth agar was taken and quadrant streaking was done.

Experiment 24: Confirmatory Test for A. baylyi

10/09/2023

Project: CarbanEl

Authors: Wet Lab Team

**Confirmatory tests for Acinetobacter baylyi:**

Confirmatory tests were performed to confirm the characteristics of the bacteria. These tests included a gram staining test, an indole spot test, and a MR-VP test.

Gram staining- A Gram staining test was performed on the culture. The cells appeared pink and the morphology was observed as coccobacillary when viewed under the microscope, confirming that they are Gram-negative.
(Figure: Microscopic view of a bacterial culture - the cells appear as dark pink dots on a lighter pink background at a magnification of 100x.)
Indole spot test- The Indole spot test was performed with the inoculated culture. A piece of Whatman filter paper was placed in a petri dish cover and saturated with Kovács reagent. The paper was then smeared with cell paste from the culture.There was no visible colour change, indicating a negative result. The organism was confirmed to lack the ability to produce tryptophanase.
(Figure: Indole negative test of Acinetobacter baylyi)
Methyl Red Voges Proskauer test preparation- The broth for the test was prepared and inoculated. It was kept in the incubator shaker for 24 hours at 37°C.
After 24 hours
1. For Methyl Red Test: Methyl Red Reagent was added.
2. For Voges Proskauer Test: Barritt Reagent A and Barritt Reagent B were added.
And a negative result was obtained. This indicates that it does not produce organic acid end products, or acid end products are enzymatically converted into non-acidic compounds. Thus proving that Acinetobacter baylyi does not ferment glucose.

(Figure: Two test tubes held up. The first one, labelled MR, light yellow liquid, indicating a negative result for the Methyl Red test. The second, labelled VP, has dark yellow liquid in it, indicating a negative result for the Voges Proskauer test.)

Test	Expected Result	Observations	Results
Gram staining	Gram-negative	Cells appeared pink when viewed under a microscope	Cells were concluded to be Gram-negative
Indole test	Negative result (No visible colour change)	Negative results were observed	Cells lack the ability to produce tryptophanase
Methyl Red test	Negative result (Culture should remain yellow)	Negative results were observed	Cells produce stable non-acidic end products following metabolism of glucose
Voges-Proskauer test	Negative result (No colour change in culture)	Negative results were observed	There is an absence of non-acidic and neutral compounds being formed as end products
Catalase Test	Evidence of catalase production	Effervescence was observed	Cells were concluded to be producing catalase

Experiment 25: Growth curve of A. baylyi in the presence of acetonitrile

10/09/2023

Project: CarbanEl

Authors: Wet Lab Team

**The effect of acetonitrile on the growth of Acinetobacter baylyi was observed**

Time (hours)	Control	Flask 1	Flask 2
0	0	0	0
1	0.02	0.023	0.0215
3	0.034	0.025	0.053
4	0.417	0.03	0.157
5	1.148	0.192	0.367
6	2.001	0.438	1.023
7	3.4	0.681	1.245
8	4.32	1.091	1.818
9	4.63	1.53	2.109
10	4.65	1.91	3.09
21.5	4.66	4.2	4.03

Result: It is observed that Acetonitrile affects the growth of Acinetobacter baylyi and acts as an inhibitor.

Experiment 26: Growth curve of A. baylyi at pH 6.5, 7.5, 8.5

14/09/2023

Project: CarbanEl

Authors: Wet Lab Team

**The effect of pH on the growth of Acinetobacter baylyi was observed**

Growth curves were prepared for Acinetobacter baylyi.
Three conical flasks were taken and labelled Flask 1, Flask 2, and Blank.
The pH was adjusted using 1N NaOH and all flasks were autoclaved.
The flasks were observed over a time period of 12 hours.

At pH 6.5:

Time (hours)	Flask 1	Flask 2
0	0	0
1	0	0
2	0.079	0.056
5	0.83	0.776
7	2.08	1.579
9	3.2	2.7
11	3.63	3.5

At pH 7.5:

Time (hours)	Flask 1	Flask 2
0	0	0
1	0.032	0.03
2	0.063	0.068
5	0.777	0.618
7	2.18	2.267
9	3.78	3.92
11	4.32	4.02

At pH 8.5:

Comparisons were drawn between growth curves at different pH levels to determine the optimal pH for growth

Result: It was observed that the growth of Acinetobacter baylyi was not significantly influenced by variation in the pH. Thus we infer that it would thrive within this pH range typically found in wastewater treatment plants.

Time (hours)	Flask 1	Flask 2
0	0	0
1	0	0
2	0.131	0.142
5	0.5	0.709
7	2.018	2.276
9	2.5	2.6
11	3.03	3.55

Time (hours)	Flask 1	Flask 2
0	0	0
1	0	0
2	0.069	0.055
3	0.139	0.058
4	0.143	0.159
5	0.201	0.34
6	0.587	0.6
7	1.015	1.088
8	1.377	1.46
9	1.68	1.878
10	2.115	2.056
11 (diluted)	2.79 (0.279)	3.18 (0.318)
12 (diluted)	2.93 (0.293)	2.89 (0.289)

15000ng/ml

Time (hours)	Flask 1	Flask 2
0.	0.024	0.059
1	0.037	0.048
2	0.119	0.049
3	0.13	0.05
4	0.135	0.042
5	0.26	0.26
6	0.415	0.48
7	0.716	0.893
8	1.215	1.189
9	1.58	1.658
10	2.032	1.992
11 (diluted)	3.06	2.51
12 (diluted)	3.36	3.67

19000ng/ml

Time (hours)	Flask 1	Flask 2
0.	0.013	0.027
1	0.004	0.039
2	0.045	0
4	0.139	0.153
5	0.091	0.271
6	0.334	0.346
7	0.868	0.993
8	1.223	1.428
9	1.749	1.814
10	2.101	2.089
11 (diluted)	2.3 (0.23)	2.66 (0.266)
12 (diluted)	4.21(0.421)	3.67(0.367)

21000 (ng/ml)

Time (hours)	Flask 1	Flask 2
0.	0	0.048
1	0	0.089
2	0.066	0.099
3	0.069	0.107
4	0.208	0.163
5	0.273	0.283
6	0.355	0.452
7	0.782	0.69
8	1.084	1.005
9	1.636	1.008
10	2.02	1.598
11 (diluted)	2.75(0.275)	3.53(0.353)
12 (diluted)	3.11(0.311)	3.98(0.398)

Results: It is observed that Acinetobacter baylyi is capable of growing in the presence of TCC. Acinetobacter baylyi and other gram negative bacteria have efflux pumps to remove toxic substances that allow it to survive¹. This might explain why A.baylyi grows in a TCC containing environment.

**Comparison of the growth of Pseudomonas putida, Pseudomonas fluorescens and Acinetobacter baylyi at different TCC concentrations**

13000ng/ml

Time (hours)	P. putida	P. fluorescens	A. baylyi
0	0	0	0
1	0.002	0	0
2	0.006	0.024	0.069
3	0.006	0.03	0.139
4	0.016	0.061	0.143
5	0.067	0.0935	0.201
6	0.126	0.165	0.587
7	0.253	0.343	1.015
8	0.49	0.53	1.377
9	0.994	0.8925	1.68

Results: It was observed that at a TCC concentration of 13,000ng/ml,Acinetobacter baylyi exhibited a better growth pattern that Pseudomonas putidaand Pseudomonas fluorescens.

21000ng/ml

Time (hours)	P. putida	P. fluorescens	A. baylyi
0	0	0.013	0
1	0	0.0215	0
2	0.001	0.0225	0.066
3	0.045	0.03	0.069
4	0.056	0.046	0.208
5	0.174	0.14	0.273
6	0.317	0.2095	0.355
7	0.535	0.4205	0.782
8	0.922	0.681	1.084
9	1.383	1.0165	1.636

Results: It was observed that at a TCC concentration of 21,000ng/ml, Acinetobacter baylyi showed higher growth followed by Pseudomonas putida and Pseudomonas fluorescens showed the least growth.

Week 7

Experiment 28: Growth curve of E. coli BL21 with transformed tccA + pET22b+

27/09/2023

Project: CarbanEl

Authors: Wet Lab Team

Time (hours)	BL21	BL21 Transformed
1	0.104	0.027
2	0.189	0.05
3	0.898	0.089
4	0.208	0.163
5	1.723	0.102
6	2.535	0.831
7	3.15	2.72
8	3.17	2.54
9	3.29	2.92
10	3.31	2.95
11	3.69	36.56

Time (hours)	BL21	BL21 Transformed
1	0.071	0.023
2	0.132	0
3	0.397	0
4	1.271	0
5	1.723	0.102
6	2.056	0.002
7	2.54	0.078
8	2.3	0.137
9	3.23	0.496
10	2.63	0.909
11	2.72	1.011

Result: Although the transformed BL21 did not grow as much as the non- transformed, TCC content in the supernatant was measured and it showed less concentration of TCC as compared to the initial concentration in which it was inoculated. The inoculated TCC concentration was observed to be 0.030 OD in LB broth and the final OD was 0.001. However, more experimentation is required to clearly conclude this result.

Week 8

Experiment 29: Growth curve of A. baylyi at 30 and 37 degree celsius

03/10/2023

Project: CarbanEl

Authors: Wet Lab Team

The effect of temperature on the growth of Acinetobacter baylyi was studied:

30 degrees Celsius

Time (hours)	Flask 1	Flask 2
0	0	0
1	0	0
2	0	0
4.5	0.042	0.04
5.5	0.043	0.055
6.5	0.123	0.181
7.5	0.44	0.64
9	1.251	1.522
11	2.7	3.05
12	3.01	3.19

37 degrees Celsius

Time (hours)	Flask 1	Flask 2
0	0.115	0
3	0.093	0.015
4	0.001	0
5	0.018	0.038
6	0.472	0.341
7	1.02	0.94
8	1.584	1.535
9	2.016	1.989
10	3.1	2.42
11	3.05	3.11
12	3.11	3.63

Comparisons were drawn between growth curves at different temperatures to determine the optimal temperature for growth.

Result: It was observed that the growth of Acinetobacter baylyi was not deterred by the change in temperature.

Experiment 30: Growth curve of Pseudomonas putida, Pseudomonas fluorescens, Acinetobacter baylyi for calibrating wet weight

09/10/2023

Project: CarbanEl

Authors: Wet Lab Team

A secondary inoculation was done for all three cultures and OD and weight was calculated every 30 minutes till the culture reached stationary state.

For Pseudomonas putida

For Pseudomonas fluorescens

For Acinetobacter baylyi

References:

Kumar, A. (2021, June 17). Update on Multidrug Resistance Efflux Pumps in Acinetobacter spp. NCBI. Retrieved October 4, 2023, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8218648/

Cloning and Expression

Experiment 1: (C&E) Amplification of tccA gene

02/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica, Nidhi Mallya

Dissolving lyophilized IDT tccA gene fragment

100 μL autoclaved Milli-Q water was added to the lyophilized tccA gene.
Invert the tube a few times.
The sample was then vortexed for 1 sec
The sample was centrifuged at 14000 rpm for 30sec and placed in ice immediately
OD was measured at 260 nm
The mixture was placed on ice
Concentration was checked at 260nm (10 μL/ mL) and stored at -20°C.

TccA Primer Synthesis for Amplification of Gene Fragment

Primer Design

Primer	Primer sequence (5’ - 3’)	Number of bases	GC content	Tm value(°C)
Forward Primer	CAGCCGGCGATGGCCATGGATATCG	25	64%	69.5
Reverse Primer	GTTAGCAGCCGGATCTCAGTGG	22	59.1%	64

Primer Report

Primer	Primer sequence (5’ - 3’)	Yield (OD)	Volume for 100 pmol/μL
Forward Primer	CAGCCGGCGATGGCCATGGATATCG	8.4	368.9
Reverse Primer	GTTAGCAGCCGGATCTCAGTGG	5	249.3

Dissolving lyophilised tccA primers
1. 368.9 μL of autoclaved Milli-Q water was added to Forward Primer, and 249.3 μL of autoclaved Milli-Q water was added to tccA Reverse Primer.
2. The mixture was gently mixed.
3. The sample was vortexed for 1 sec.
4. The sample was centrifuged at 14000 rpm for 30sec.
5. The sample was placed in ice immediately.
6. 10 μL of sample was taken and dissolved in 90 μL of Milli-Q water.
7. Pipette mix it GENTLY.
8. Check OD at 260nm and stored at -20 °C

PCR Reaction Mix Preparation for tccA Gene Amplification

A reaction mixture for 50 μL PCR Reaction was prepared in a 0.2 mL PCR tube
Thus, the Total PCR Reaction Mixture = 50 μL
The total 50 μL PCR reaction mixture was then divided into two separate 0.2 mL PCR tubes, each having 25 μL. The 3 PCR reaction mixtures were divided finally into 6 samples.

Component	Volume	Concentration Available	Volume	For 10 Reactions
Q5 High-Fidelity 2X Master Mix	12.5 ul	2X	1.25 ul	62.5 ul
10uM Forward Primer	1.25 ul	10 mM	1.25 ul	6.25 ul
10uM Reverse Primer	1.25 ul	10 mM	1.25 ul	6.25 ul
Template DNA	1 pg - 10ng		10ng (1 full)	5 ul
Nuclease-Free Water	To make 25 ul		To make 25 ul	45 ul
Total Volume	25 ul		25 ul

Component	Negative-1	Negative-2	Positive
Q5 High-Fidelity 2X Master Mix	12.5 ul		1.25 ul
10uM Forward Primer	1.25 ul	1.25 ul	1.25 ul
10uM Reverse Primer	1.25 ul	1.25 ul	1.25 ul
Template DNA		5 ng (0.5 ul of 10ng/ul)	10ng (1 full)
Nuclease-Free Water	To make 25 ul	To make 25 ul	To make 25 ul
Total Volume	25 ul	25 ul	25 ul

For negative control- 1. No template DNA 2. No Q5 For positive control- Mam7 (mam7 was used as it has been already used it our lab with consistent Results and standardised protocols)

Thermocycling Conditions for tccA Gene Amplification through PCR
(Thermocycling conditions for tccA gene amplification)

Annealing Temperature- Gradient PCR from 55 C- 72 C.
PROTOCOL FOR GRADIENT PCR:
- CalcuLations were made for a master mix containing water, 2X Q5 high-fidelity master mix from NEB, and primers. If n reactions are required, prepare a master mix for n+1 reactions.
- This master mix was prepared in an 0.5 mL Eppendorf tube and aliquoted into 9 separate PCR tubes for 8 samples for gradient PCR and sample 11 (negative control with no DNA). Sample 9 was the negative control with 10 ng of tccA and water.
- Sample 10 was a positive control with the MAM7 gene.
Running of gel electrophoresis for Amplified tccA
(Lane 1 of Gel 1 and Gel 2: 1kb DNA ladder
Lane 2-7 in Gel 1: tccA amplified 55-
Lane 2-3 in Gel 2: tccA amplified)

Experiment 2: (C&E) Amplification of tccA gene

04/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica, Nidhi Mallya

PCR Reaction Mix Preparation for tccA Gene Amplification

A Master Mix for 50 μL PCR Reaction Mixture was prepared in a 0.2 mL PCR tube
Thus, the Total PCR Reaction Mixture = 50 μL
The total 50 μL PCR reaction mixture was then divided into two separate 0.2 mL PCR tubes, each having 25 μL. The 3 PCR reaction mixtures were divided finally into 6 samples.

Component	Volume	Concentration Available	Volume	For 10 Reactions
Q5 High-Fidelity 2X Master Mix	12.5 ul	2X	1.25 ul	62.5 ul
10uM Forward Primer	1.25 ul	10 mM	1.25 ul	6.25 ul
10uM Reverse Primer	1.25 ul	10 mM	1.25 ul	6.25 ul
Template DNA	1 pg - 10ng		10ng (1 full)	5 ul
Nuclease-Free Water	To make 25 ul		To make 25 ul	45 ul
Total Volume	25 ul		25 ul

Component	Negative-1	Negative-2	Positive
Q5 High-Fidelity 2X Master Mix	12.5 ul		1.25 ul
10uM Forward Primer	1.25 ul	1.25 ul	1.25 ul
10uM Reverse Primer	1.25 ul	1.25 ul	1.25 ul
Template DNA		5 ng (0.5 ul of 10ng/ul)	10ng (1 full)
Nuclease-Free Water	To make 25 ul	To make 25 ul	To make 25 ul
Total Volume	25 ul	25 ul	25 ul

For negative control- 1. No template DNA 2. No Q5 For positive control- Mam7

Thermocycling Conditions for tccA Gene Amplification through PCR
(Thermocycling conditions for tccA gene amplification)

Annealing Temperature- Gradient PCR from 67C- 69 C.

PROTOCOL FOR GRADIENT PCR:
- CalcuLations were made for a master mix containing water, 2X Q5 high-fidelity master mix, and primers. If n reactions are required, prepare a master mix for n+1 reactions.
- This master mix was prepared in an Eppendorf tube and aliquoted into 9 separate PCR tubes for 8 samples for gradient PCR and sample 11 (negative control with no DNA). Sample 9 was the negative control with 10 ng of tccA and water.
- Sample 10 was a positive control with the MAM7 gene.
Running of gel electrophoresis for Amplified tccA (RUN 2)

Experiment 3: (C&E) Primary Inoculation of DH5alpha and pET22b+ in LB broth

05/09/2023

Project: CarbanEl

Authors: I Vidhula Jessica, Aditi Balasubramani, Manu Upadhye

**Primary inoculation of E.coli DH5alpha**

200 μL of DH5alpha glycerol stock was inoculated in 5 mL of LB broth
A heat fixed loop was used to pick a colony from pET22b+ plate and Inoculated into 5 mL of LB broth with 5 μL of Ampicillin

Result: No growth was observed in the test tubes inoculated with pET22b+

Conclusion:The experiment to be repeated, after streaking new plates of pET22b+ dh5alpha plate.

Experiment 4: (C&E) PCR cleanup

06/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, Manu Upadhye

PCR cleanup (QIAGEN):

Lanes from the lower range of temperature (65-67) was purified

Each separate 25 μL of Amplified tccA
125 μL of Buffer PB was added to the tccA amplified mix.
The mixture was then transferred to a QIAquick column which was placed in the provided 2 mL collection tube.
The column was centrifuged for 30–60s at 13000rpm, 32°C
The flow-through was then discarded, and the QIAquick column was placed back in the same tube.
750 µl Buffer PE was added to the QIAquick column and centrifuged for 30–60s at 13000rpm,32°C for washing.
The QIAquick column was once again centrifuged for 1min at 13000rpm, 32°C in a new 2 mL collection tube that was provided to remove residual wash buffer.
The QIAquick column was then placed in an autoclaved 1.5 mL Eppendorf tube.
25 μL of Buffer EB (10 mM Tris·Cl, pH 8.5) was added to the centre of the QIAquick membrane and let to stand for 1min
The QIAquick column was centrifuged for 1min at 13000rpm, 32°C to elute the DNA.
To the same QIAquick membrane, 15 μL of Buffer EB was added to the centre and placed in a new 2 mL collection tube that was provided, which was centrifuged for 1min at 13000rpm, 32°C to elute the DNA again.
The concentration of the gene was determined by a UV spectrophotometer at 260nm.

Lane	Concentration (ug/mL)
1	30.7
2	14.2
3	24.7
4	36.6

Experiment 5: (C&E)Primary inoculation of pET22b+

08/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

A heat sterilised loop was used to pick a colony from pET22b+ plate and Inoculated into 5 mL of LB broth with 5 μL of Ampicillin
The test tube was incubated at 37 °C for 16 hours at 180rpm.

Experiment 6: (C&E)Plasmid isolation of pET22b+

09/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Plasmid Isolation of pET22b+ (QIAGEN miniprep kit)

The culture samples (1-10) were pelleted by centrifuging at 13000rpm for 10min, 4°C
The pelleted bacterial cells were resuspended in 250 μl Buffer P1 and transferred to a microcentrifuge tube.
250 μl of Buffer P2 was added and mixed thoroughly by inverting the tube 4–6 times until the solution became clear.
350 μl of Buffer N3 was added and mixed immediately and thoroughly by inverting the tube 4–6 times.
The mixture was then centrifuged for 10 min at 13,000 rpm (~17,900 x g) in a table-top microcentrifuge.
800 μl of the supernatant was added to a QIAprep 2.0 spin column by pipetting.
The mixture was then centrifuged for 30–60 s at 13000rpm and the flow-through was discarded
The QIAprep 2.0 spin column was washed by adding 0.75 mL Buffer PE. m. The mixture was centrifuged for 30–60 s for 13000rpm
The QIAprep 2.0 spin column was transferred to the collection tube.
The tube was then centrifuged for 1 min to remove the residual wash buffer.
The QIAprep 2.0 column was placed in a clean 1.5 mL microcentrifuge tube.
To elute DNA, 30 μl of Buffer EB (10 mM Tris-HCl, pH 8.5) was added first to the center of the QIAprep 2.0 spin column, and let stand for 5 minutes, then centrifuged for 1 min at 13000rpm.
The elution was again done by adding 15 μl of Buffer EB (10 mM Tris-HCl, pH 8.5) and was let to stand for 4min, centrifuged at 13000rpm for 1min.
The OD Value of the Isolated plasmid was then measured using a spectrophotometer.

Plasmid Sample	Concentration (in ug/ mL)
1	81.7

Week 2

Experiment 7: (C&E)Plasmid isolation of pET22b+

10/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

To ensure sufficient stock of the plasmid, we performed plasmid isolation again with the same protocols as above and measured concentration.

Plasmid Sample	Concentration (in ug/mL)
1	120.3
2	53.7

Experiment 8: (C&E)Double Digestion of tccA and pET22b+

14/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Double digest of amplified tccA and pET22b+ with BamHI and XhoI

Double digestion reaction mix preparation for tccA gene and pET22b+ vector as follows:

Component	TccA	pET22b+
Template DNA	(for 250ng of insert)	(for 250ng of vector)
10X cut smart buffer	2.5	2.5
XhoI enzyme	0.25	0.25
BamHI enzyme	0.25	-0.25
MilliQ water	Make upto 25 μL	Make upto 25 μL
Total Volume	25	25

Thermocycling conditions for double digest of amplified tccA and pET22b+

Step	Temperature (°C)	Time
Incubation	37	3 hours
Enzyme inactivation (BamHI and XhoI)	65	20 minutes
Hold	4	Infinite

(lane 1- 1kb ladder, lane 2,3,4-pET22b+, lane 5,6,7- tccA amplified)

Week 3

Experiment 9: Primary inoculation for competent cell preparation

21/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Primary inoculation for competent cell preparation

200 μL of E.coli DH5alpha glycerol stock was Inoculated into a test tube with 5 mL of LB broth and another test tube was taken and 2 mL of LB broth was added as blank.
The test tubes were incubated at 37 °C, 180 rpm for 16 hours.

Experiment 10: (C&E)Gibson Assembly

22/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Gibson assembly (NEB E5510S kit was used)

Component	Volume(μl)	Concentration Available
Gibson Assembly Master Mix	10	2X
Template DNA	2	50 ng/μl
Insert DNA	0.25	38 ng/μl
Nuclease-free Water	7.25
Total Volume	20

Experiment 11: (C&E)Competent cell preparation and Transformation

22/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Transformation of Gibson assembled tccA + pET22b+ to E.coli dh5alpha using CaCl2 method.

Chemical and Media Preparation
1. 0.1M CaCl2
  1. 11.1g of anhydrous CaCl2 was weighed out and added to 80 mL of autoclaved distilled water.
  2. The solution was mixed until the CaCl2 was fully dissolved
  3. The solution was then topped up to 100 mL
  4. 10 mL of the above solution was taken and then diluted by adding 90 mL of autoclaved distilled water for 1:10 dilution
  5. The solution was then filter sterilized through a PVDF filter of pores size 0.22μm.
2. LB Ampiclin plates (X10)
  1. 6g of LB agar powder was weighed out and added to 250 mL of distilled water
  2. The LB agar solution was then autoclaved. 0.25 μL of Ampiclin was then dissolved into the LB agar solution
  3. 25 mL of LB-ampicillin solution was then poured into each Petri plate.
3. 100 mL LB broth
  1. 2.5g of LB broth powder was weighed out and added to 100 mL of distilled water
  2. The LB broth solution was then autoclaved.
Competent Cell preparation
1. E.coli DH5-alpha culture preparation One culture sample were prepared with one blank containing just the LB broth
2. The sample was transferred to 15 mL falcon tubes that were placed on ice.
3. The falcon tube was then centrifuged at 4°C at 5600g for 10 minutes for pelleting the DH5-alpha culture.
4. The supernatant was discarded.
5. Each pellet was then resuspended with 1 mL ice-cold 0.1M CaCl2.
6. The total 2 mL cell suspension was then incubated on ice for 30 minutes
7. The suspension was then again centrifuged at 4°C at 5600g for 10 minutes
8. The supernatant was discarded
9. Each pellet was then again resuspended in 500 μL of ice-cold 0.1M CaCl2.
10. Five 100 μL aliquots of competent cells were prepared in ice-cold 1.5 mL eppendorf tube
11. The prepared competent cells were then stored at -80°C
Transformation
1. 10ng of plasmid (pET22b+) was added to each aliquot (For required transformant and positive control)
2. The cells were then incubated on ice for 30 minutes
3. The cells were then placed in a 42°C water bath for exactly 30 seconds
4. The cells were again placed on ice for 2 minutes
5. 1 mL of pre-warmed LB media was then added to each aliquot.
6. The aliquots or cells were then incubated at 37°C, 200rpm for 1-hour.
Plating and incubation
1. 100 μL of the transformed cells from the aliquots of transformed cells were then spread plated on the LB ampicillin plates.
2. The plates were then incubated at 37°C for 12-16 hours.

Result: 23/09/2023

Viewed transformed plates

Blank (dh5alpha on LB Ampicillin Plate)

(LB Ampicillin plate with empty vector pET22b+)

(Transformed plate-contains tccA gibson assembled pET22b+ transformed DH5alpha cells)

Experiment 12: (C&E)Colony Polymerase Chain Reaction

23/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Colony PCR(try 1)

PCR reaction Mix preparation for colony PCR of transformed cells

Colony Cell suspension preparation:
A freshly autoclaved micropipette was touched onto an isolated colony and then dipped into the respective Eppendorf tube containing 100 μL of Nuclease-free (autoclaved Milli-Q) water.
A colony PCR was done for 10 colonies with 25 μL of the colony PCR mix for each colony

Thus each PCR reaction mix consisted of:

Component	Volume (μL)
Q5 Master Mix (2X) (from NEB)	12.5
TccA Forward Primer	1.5
TccA Reverse Primer	1.5
Autoclaved MilliQ Water	8.5
Colony Cell Suspension	1.0
Total	25

A positive control was prepared of 25 μL.

Thermocycling conditions for colony PCR

Step	Temperature °C	Time	Cycles
Initial Denaturation and Lysis	98	3 minutes	-
Cycling Denaturation	98	15 seconds	30 Cycles
Cycling Annealing	51	30 seconds	30 Cycles
Cycling Extension	72	90 seconds	30 Cycles
Final Extension	72	10 minutes	-
Hold	-	-	-

Gel electrophoresis for Colony PCR

Preparation of 1% agarose Gel
1. 0.3 g of agarose was weighed and added to 30 mL of 1X TAE to give 1% agarose gel.
2. The agarose was boiled till it dissolved completely in a clear solution
3. 2 μL of SYBR safe dye (invitrogen) was added to the solution

Electrophoresis:

The electrophoresis combs were set to be approximately 2 cm away from the cathode
The agarose solution was poured into the central part of the tank when the temperature reached approximately 60 °C.
The gel was kept undisturbed at room temperature fro the agarose to solidify.
1X TAE buffer was poured into the gel tank till the buffer level stodd at 0.5-0.8cm above the gel surface
The combs were gently lifted ensuring the wells remained inatact.
The power cord was connected to the electrophoretic power supply

Well	DNA Template	Volume of Reaction Mixture	Volume of Gel Dye
1 (of both gels)	Ladder (1kb)	6 μL	-
2-7 (gel 1)	Colony 1-6	25 μL	4
2-5 (gel 2)	Colony 7-10	25 μL	4

Result:

DNA ladder did not show up in the UV transilluminator, co μLd be due to inappropriate preparation of ladder,

Conclusion: Repeat the experiment after vortexing the DNA ladder before loading.

Inoculated 10 colonies in LB for plasmid isolation

From the cell suspension sample, 50 μL was Inoculated into 5 mL of LB broth containing ampicillin (5 μL).
The test tubes were incubated in 37 °C at 180 rpm.

(Colony PCR result: Ladder is not visible, the experiment was repeated again)

Experiment 13: (C&E)Plasmid isolation for selected colonies

24/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Plasmid isolation (QIAGEN miniprep Kit)

The culture samples (1-10) were pelleted by centrifuging at 13000rpm for 10min, 4°C
The pelleted bacterial cells were resuspended in 250 μl Buffer P1 and transferred to a microcentrifuge tube.
250 μl of Buffer P2 was added and mixed thoroughly by inverting the tube 4–6 times until the solution became clear.
350 μl of Buffer N3 was added and mixed immediately and thoroughly by inverting the tube 4–6 times.
The mixture was then centrifuged for 10 min at 13,000 rpm (~17,900 x g) in a table-top microcentrifuge.
800 μl of the supernatant was added to a QIAprep 2.0 spin column by pipetting.
The mixture was then centrifuged for 30–60 s at 13000rpm and the flow-through was discarded
The QIAprep 2.0 spin column was washed by adding 0.75 mL Buffer PE. m. The mixture was centrifuged for 30–60 s for 13000rpm
The QIAprep 2.0 spin column was transferred to the collection tube.
The tube was then centrifuged for 1 min to remove the residual wash buffer.
The QIAprep 2.0 column was placed in a clean 1.5 mL microcentrifuge tube.
To elute DNA, 30 μl of Buffer EB (10 mM Tris-HCl, pH 8.5) was added first to the center of the QIAprep 2.0 spin column, and let stand for 5 minutes, then centrifuged for 1 min at 13000rpm.
The elution was again done by adding 15 μl of Buffer EB (10 mM Tris-HCl, pH 8.5) and was let to stand for 4min, centrifuged at 13000rpm for 1min.
The OD Value of the Isolated plasmid was then measured using a spectrophotometer at 260nm.

Colony	Concentration (ug/mL)
1	60.8
2	38.4
3	39.6
4	43.2
5	24.0
6	32.1
7	46.8
8	35.6
9	36.9
10	54.6

Experiment 14: (C&E)Streaking of Master Plate

25/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Streaked master plate for the colonies

An inoculation loop was heat sterilised and plate was streaked for each colony to prepare a master plate

(All 10 colonies from the cell suspension streak plated)

Result (25/09/2023):

Viewed master plate after 24 hours

Week 4

Experiment 15: (C&E) Double digestion of isolated Plasmid (tccA+pET22b+)

28/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Double digestion of Gibson assembled tccA + pET22b+ cloned in DH5alpha

This experiment was carried out as an additional step to ensure the presence of the insert in the pET22b+

Double digestion reaction mix preparation

Component	Volume
template	(500ng of vector)
10X cutsmart buffer	5 μL
XhoI enzyme	0.5 μL
BamHI enzyme	0.5 μL
Nuclease Free water	Make upto 50 μL
Total	50 μL

Thermocycling conditions for pET22b+ double digestion

Step	Temperature (°C)	Time
Incubation	37	3 hours
Enzyme inactivation (BamHI and XhoI)	65	20 minutes
Hold	4	Infinite

Result:

(Lane 1 of Gel 1 and 2 – 1kb DNA ladder
Lane 2-7 of gel 1 – digestion of plasmid from colony 1-5 and 8-9
Lane 2 of gel 2 – digestion of plasmid from colony 10
Lane 3 of gel 2 – positive control)

Experiment 16: (C&E)Colony Polymerase Chain Reaction

28/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Colony PCR (try 2)

PCR reaction Mix preparation for colony PCR of transformed cells:

Colony Cell suspension preparation:
A freshly autoclaved toothpick was touched onto a colony and then dipped into the respective Eppendorf tube containing 100 μL of Nuclease-free (autoclaved Milli-Q) water.
A colony PCR was done for 10 colonies with 25 μL of the colony PCR mix for each colony

Thus each PCR reaction mix consisted of:

Component	Volume (μL)
Q5 Master Mix (2X) (from NEB)	12.5
T7 Forward Primer	1.5
TccA Reverse Primer	1.5
Autoclaved MilliQ Water	8.5
Colony Cell Suspension	1
Total	25

A positive control was prepared of 25 μL.

Thermocycling conditions for colony PCR

Step	Temperature °C	Time	Cycles
Initial Denaturation	98	3 minutes	-
Cycling Denaturation	98	15 seconds	30 cycles
Cycling Annealing	51	30 seconds	30 cycles
Cycling Extension	72	90 seconds	30 cycles
Final Extension	72	10 minutes	-
Hold	4	Indefinite	-

Gel electrophoresis for Colony PCR

Preparation of 1% agarose Gel
1. 0.3 g of agarose was weighed and added to 30 mL of 1X TAE to give 1% agarose gel.
2. The agarose was boiled till it dissolved completely in a clear solution
3. 2 μL of SYBR safe dye (Invitrogen) was added to the solution
Electrophoresis:
1. The electrophoresis combs were set to be approximately 2 cm away from the cathode
2. The agarose solution was poured into the central part of the tank when the temperature reached approximately 60 °C.
3. The gel was kept undisturbed at room temperature fro the agarose to solidify.
4. 1X TAE buffer was poured into the gel tank till the buffer level stodd at 0.5-0.8cm above the gel surface
5. The combs were gently lifted ensuring the wells remained inatact.
6. The power cord was connected to the electrophoretic power supply

Well	DNA template	Volume of reaction mixuture (μL)
1 (of both gels)	Ladder (1kb)	6	-
2-7 (gel 1)	Colony 1-6	25	4
2-5 (gel 1)	Colony 7-10	25	4

1kb ladder was loaded after vortexing:

(Lane 1 of gel 1 and 2- 1kb DNA Ladder
Lane 2-7 of gel 1- Colony PCR of colonies 1-7
Lane 2-4 of gel 2- Colony PCR of colonies 8-10
Lane 5 of gel 2- Positive control
However, we are unsure of the marks on gel 2, it could be due to unequal mixing of dye during preparation of agarose)

Experiment 17: (C&E)Primary inoculation for competent cell preparation (BL21)

29/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

A heat sterilised loop was used to pick a colony from BL21 plate and Inoculated into 5 mL of LB broth

The test tube was incubated at 37 °C Celsius for 16 hours at 180rpm.

Experiment 18: (C&E)Competent cell preparation and transformation (BL21)

30/09/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Transformation of Gibson assembled tccA + pET22b+ to E.coli BL21 using CaCl2 method.

Chemical and Media Preparation
1. 0.1M CaCl2
  1. 11.1g of anhydrous CaCl2 was weighed out and added to 80 mL of autoclaved distilled water.
  2. The solution was mixed until the CaCl2 was fully dissolved
  3. The solution was then topped up to 100 mL
  4. 10 mL of the above solution was taken and then diluted by adding 90 mL of autoclaved distilled water for 1:10 dilution
  5. The solution was then filter sterilized through a PVDF filter of pores size 0.22μm.
2. LB Ampicillin plates (X10)
  1. 6g of LB agar powder was weighed out and added to 250 mL of distilled water
  2. The LB agar solution was then autoclaved ● 0.25 μL of Ampicillin was then dissolved into the LB agar solution.
  3. 25 mL of LB-ampicillin solution was then poured into each Petri plate.
3. 100 mL LB broth
  1. 2.5g of LB broth powder was weighed out and added to 100 mL of distilled water
  2. The LB broth solution was then autoclaved.
Competent Cell Preparation
1. E.coli BL21 culture preparation One culture sample were prepared with one blank containing just the LB broth
  1. 200 μL of E.coli BL21 from the glycerol stock was Inoculated onto 5 mL of LB
  2. The culture was then incubated at 37°C and 200rpm for 16 hours.
  3. The amount of growth of BL21 culture was measured using a spectrophotometer at absorbance A600.
2. The sample was transferred to 15 mL falcon tubes that were placed on ice.
3. The falcon tube was then centrifuged at 4°C at 6000rpm for 10 minutes for pelleting the BL21 culture.
4. The supernatant was discarded.
5. Each pellet was then resuspended with 1 mL ice-cold 0.1M CaCl2.
6. The total 2 mL cell suspension was then incubated on ice for 30 minutes
7. The suspension was then again centrifuged at 4°C at 6000rpm for 10 minutes
8. The supernatant was discarded.
9. Each pellet was then again resuspended in 500 μL of ice-cold 0.1M CaCl2.
10. Five 100 μL aliquots of competent cells were prepared in ice-cold 1.5 mL falcon tubes
11. The prepared competent cells are then stored at -80°C.
Transformation
1. 10ng of plasmid was added to each aliquot (For required transformant and positive control)
2. The cells were then incubated on ice for 30 minutes
3. The cells were then placed in a 42°C water bath for exactly 30 seconds
4. The cells were again placed on ice for 2 minutes,
5. 1 mL of pre-warmed LB media was then added to each aliquot.
6. The aliquots or cells were then incubated at 37°C, 200rpm for 1-hour.
7. In order to increase the concentration/ efficiency, centrifuged to pellet down the cells for 4 minutes at 4000rpm, discarded 700-750 μL of supernatant and resuspended the pellet.
Plating and incubation:
1. Rest of the transformed cells from the aliquots of were then spread plated on the LB ampicillin plates.
2. The plates were then incubated at 37°C for 12-16 hours.
  (Blank)
  
  Competent cells plated on LB plate with ampicillin
  (This shows that the ampicillin is working)
  
  (Competent cells transformed with pET22b+ empty vector)
  
  (Transformed E.coli BL21 with tccA+pET22b+)

Experiment 19: (C&E)Expression Studies: inoculation

01/10/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Expression Studies

From the transformed plate, streak plate one single colony and grow it.
Inoculate from that plate into 3 mL of LB broth, 37 °C, 180rpm overnight.

Experiment 21: (C&E)Expression Studies

04/10/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

After 48 hour incubation, the OD was checked at 600nm.

The pelleted down uninduced cells were resuspended into the broth again and OD was checked.

To get a uniform result, we diluted the higher OD as follows:

Experiment 22: (C&E)Expression Studies: SDS PAGE

04/10/2023

Project: CarbanEl

Authors: Aditi Balasubramani, I Vidhula Jessica

Clean the glass plates and spacers of the gel casting unit with deionized water and ethanol.
Assembled the plates with the spacers on a stable, even surface.

Prepared resolving gel solution using the following volumes for 12.5%:

Component	Resolving Gel
MilliQ water	1.151 mL
30.8% Acrylamide	2.079 mL
1M Tris: pH 8.8	1.663 mL
10% SDS	50 microL
10% APS (freshly prepared)	50 microL
TEMED	5 microL

Poured the gel solution in the plates assembled with spacers. To maintain an even and horizontal resolving gel surface, overlayed the surface with ethanol
The gel was allowed to set for about 20-30 min at room temperature.

Prepared stacking gel solution using the following volumes:

Component	Stacking Gel
MilliQ water	1.752 mL
30.8% Acrylamide	0.369 mL
1M Tris: pH 6.8	0.324 mL
10% SDS	25 microL
10% APS (freshly prepared)	25 microL
TEMED	3 microL

Discarded the overlayed ethanol on the resolving gel
Added the 5% stacking gel solution until it overflows. Inserted the comb immediately ensuring no air bubbles were trapped in the gel or near the wells.
Allowed the gel to set for about 20-30 min at room temperature.

Sample Preparation and loading

1mL of loading buffer was added to each of the samples (Induced and Uninduced) of 1mL each and incubated at 99 degrees for 20 minutes.

These samples were then loaded onto the gel with two ladders and electrophoresis was carried out at 50V for 3 hours.

The gel was then carefully removed placed in a plastic container and Coomassie Blue dye was added and left overnight on the shaker.

Then destaining solution was added and kept for 4 hours then observed under white light.

Results:

(SDS gel image- Lane 1,2,5,6 uninduced cells, Lane 3,4,7,8 induced cells)

Conclusion: No distinct clear bands were observed, could be due to extended time for destaining. The experiment will be repeated.

Detection

Experiment 1: Finding the best-suited solvent for preparation of standards

18/07/2023

Project: CarbanEl
Authors: Manu Upadhye

Preparation of standards with various solvents for TCC detection: water, acetone, and acetonitrile.
It was found in literature that TCC was insoluble in water, and we concluded in our experiments that acetone was too volatile.

Experiment 2: TCC Detection: Preparation of standards (using water as solvent)

18/07/2023

Project: CarbanEl
Authors: Aditi Balasubramani Manu Upadhye, Rajat Sreeraj, Vidhula Jessica

1.0 mg of TCC was added to 10 ml of water and vortexed to create a solution.
The solution was then heated.
The compound did not dissolve in water. This is due to Triclocarban’s low solubility in water (approx. 50 ng cm^-3)
Through a literature search, we came to the conclusion that TCC was not soluble in water. Hence, we switched to using other solvents.

Experiment 3: Preparation of standards (using acetone as solvent)

19/07/2023

Project: CarbanEl
Authors: Aditi Balasubramani, Manu Upadhye, Rajat Sreeraj, Vidhula Jessica

Preparation of standards (using acetone as solvent)

1.0 mg of TCC was added to 10ml of acetone (100ppm), and serial dilution was performed until 1ppm solution was obtained. The solution was then homogenised, and the absorbance and peaks were detected using a UV spectrophotometer (Figure 1).
As the peaks were detected, serial dilution was performed in the range 25ppb-250ppb and absorbance and peaks were detected for the same (Figure 2).

Comments:

The absorbance values were found to be largely negative. Hence, one wavelength was fixed, and the absorbance of the same solutions was detected. Multiple readings were taken with different concentrations of TCC, and the peak was obtained at 260nm and absorbance as 0.025.

Experiment 4: Preparation of standards for detection (with acetone as solvent)

20/07/2023

Project: CarbanEl
Authors: Manu Upadhye, Vidhula Jessica

Attempt 2:

As the first attempt did not have a positive result, the wavelength was fixed at 260nm, and samples with different concentrations of TCC, in the range of 25ppb-250ppb, were taken, and absorbance was measured as in Table 1a and 1b.

Try 1:

Concentration of TCC (ppb)	Absorbance (260nm)
25	0
50	0
75	0
100	0
150	0.018
200	0.008
250	0.009

(Table 1a)

Try 2:

Concentration of TCC (ppb)	Absorbance (260nm)
25	0.025
50	0.018
75	0.026
100	0.022
150	0.064
200	0.010
250	0.103

(Table 1b)

(Table 1a, 1b: Absorbance values of solutions with different concentrations of TCC ranging from 25-250ppb)

Experiment 5: Preparation of standards for detection of TCC (with acetone as solvent)

21/07/2023

Project: CarbanEl
Authors: Manu Upadhye, Vidhula Jessica

Attempt 3: As previous attempts were unsuccessful, another attempt was made to prepare standards using acetone. Standards were prepared with the concentrations of TCC varying from 1000-4000 ppm. However, positive results were not obtained.

From this, it was concluded that acetone is a volatile solvent whose concentration can vary with time; this makes it unsuitable for our experimentation. After a literature survey, an alternative solvent was decided upon.

×

Experiment 6: Preparation of standards for TCC detection (with acetonitrile as solvent)

01/08/2023

Project: CarbanEl
Authors: Manu Upadhye, Rajat Sreeraj

We commenced our attempts to prepare standards using acetonitrile. 1.0 mg of TCC was measured and dissolved in 10 ml of acetonitrile. The solution was labelled with the concentration (100ppm). This was further diluted to 1ppm by taking 0.1 ml of the 100 ppm solution and adding it to 9.9ml of Acetonitrile. Acetonitrile was taken as blank for this experiment.
The preparation of standards was done as follows:

TCC Concentration (ppb)	Volume of 1 ppm solution (ml)	Volume of Acetonitrile (ml)
25	0.25	9.75
50	0.5	9.5
75	0.75	9.25
100	1.0	9.0

Results:

Concentration of TCC (ppb)	Absorbance (260nm)
25	0.015
50	0.034
75	0.057
100	0.069

(The above graph depicts the relationship between the concentration of TCC (in ppb) and absorbance at 260 nm)

Experiment 7: Preparation of standards for TCC detection (with acetonitrile as solvent)

02/08/2023

Project: CarbanEl
Authors: Manu Upadhye, Vidhula Jessica

1.0 mg of TCC was measured and dissolved in 10 ml acetonitrile. The solution was then labelled (100 ppm). Acetonitrile was taken as blank for this experiment. 1.0 ml of the first solution was pipetted out and added to another test tube containing 9 ml and was labelled. (10ppm)

The preparation of standards was done as follows:

TCC Concentration (ppb)	Volume of 10 ppm solution (ml)	Volume of Acetonitrile (ml)
100	0.1	9.9
250	0.25	9.75
500	0.5	9.5
1000	1.0	9.0

Results:

TCC Concentration (ppb)	Absorbance 1 (260nm)	Absorbance 2 (260nm)	Absorbance 3 (260nm)	Absorbance 4 (260nm)	Absorbance 5 (260nm)	Averange Absorbance (260nm)
100	0.011	0.011	0.011	0.012	0.013	0.0116
250	0.021	0.023	0.023	0.023	0.022	0.0224
500	0.045	0.047	0.047	0.048	0.048	0.047
1000	0.117	0.18	0.122	0.122	0.124	0.1206

Figure: A graph depicting absorbance values for various concentrations of TCC is shown. Calculation of LOD required a minimum of 6 readings to obtain a good quality curve.

Experiment 8: Detection of TCC in ppb concentrations and plotting calibration curve (with standards prepared with acetonitrile as solvent)

03/08/2023

Project: CarbanEl
Authors: Manu Upadhye, Rajat Sreeraj

1.0 mg of TCC was measured and dissolved in 10 ml acetonitrile. Then, the solution was labelled with the concentration amount (100ppm). Acetonitrile was taken as blank for this experiment.

1.0 ml of the first solution was pipetted out and added to another test tube containing 9 ml after labelleling. (10ppm)

To prepare the standards:

TCC Concentration (ppb)	Volume of 10 ppm solution (ml)	Volume of Acetonitrile (ml)
100	0.1	9.9
250	0.25	9.75
500	0.5	9.5
1000	1.0	9.0
2000	2.0	8.0
3000	3.0	7.0

Observation: Absorbance was detected for the standard samples five times and average absorbance was considered, as shown in the table below;

TCC Concentration (ppb)	Absorbance 1 (260nm)	Absorbance 2 (260nm)	Absorbance 3 (260nm)	Absorbance 4 (260nm)	Absorbance 5 (260nm)	Averange Absorbance (260nm)
100	0.017	0.018	0.018	0.018	0.019	0.018
250	0.035	0.035	0.036	0.036	0.036	0.0356
500	0.063	0.063	0.064	0.064	0.066	0.064
1000	0.158	0.159	0.160	0.160	0.160	0.1594
2000	0.308	0.307	0.308	0.308	0.309	0.308
3000	0.421	0.421	0.423	0.423	0.424	0.4224

Figure: Graph depicting absorbance values for various concentrations of TCC.

Experiment 9: Detection of TCC in ppb concentrations and plotting calibration curve (with standards prepared with acetonitrile as solvent)

04/08/2023

Project: CarbanEl
Authors: Manu Upadhye, Vidhula Jessica

Standards were then prepared for TCC detection using acetonitrile. The following results were obtained:

TCC Concentration (ppb)	Absorbance 1 (260nm)	Absorbance 2 (260nm)	Absorbance 3 (260nm)	Absorbance 4 (260nm)	Absorbance 5 (260nm)	Averange Absorbance (260nm)
100	0.002	0.002	0.003	0.004	0.002	0.0026
250	0.020	0.019	0.019	0.020	0.020	0.0196
500	0.027	0.026	0.027	0.027	0.028	0.027
1000	0.043	0.042	0.044	0.043	0.043	0.043
2000	0.131	0.131	0.131	0.132	0.131	0.1312
3000	0.225	0.225	0.224	0.222	0.225	0.2242

Figure: Graph depicting absorbance values for various concentrations of TCC.

×

Experiment 10: Preparation of standards for TCC detection (for LCMS)

15/08/2023

Project: CarbanEl
Authors: Manu Upadhye

A solution of TCC and acetonitrile was prepared with a concentration of 100 ppm. Samples in the range of 100 ppb – 3000 ppb were prepared as follows:

TCC Concentration (ppb)	Volume of 10 ppm solution (ml)	Volume of Acetonitrile (ml)
100	0.1	9.9
250	0.25	9.75
500	0.5	9.5
1000	1.0	9.0
2000	2.0	8.0
3000	3.0	7.0

These samples are to be shipped off to an external party to be analysed using an LCMS system

×

Experiment 11: Preparation of standard solutions for the byproduct 4-CA

02/10/2023

Project: CarbanEl
Authors: Manu Upadhye, Aritro Biswas

To prepare 100ppm solution of 4-CA, which is a degradation product of TCC; 1mg of 4-CA is taken and added to 10ml of Acetonitrile

TCC Concentration (ppm)	Volume of 100 ppm solution (ml)	Volume of Acetonitrile (ml)
1	0.1	9.9
5	0.5	9.5
10	1.0	9.0
15	1.5	8.5
20	2.0	8.0
30	3.0	7.0

Our calibration curve for 4-CA The effect of 4-CA concentration on OD is shown here. (267nm)
A scan was run with the 10ppm solution from 220nm to 300nm to find the wavelength to run the standard solutions on. The peak we got was 267.

Experiment 12: Preparation of standard solutions for the byproduct 3,4-DCA

02/10/2023

Project: CarbanEl
Authors: Manu Upadhye, Aritro Biswas

TTo prepare 100ppm solution of 3,4-DCA, a degradation byproduct of TCC other than 4-CA; 1mg of 3,4-DCA is taken and added to 10ml of Acetonitrile Further dilution is done to obtain samples of lower concentration.

TCC Concentration (ppm)	Volume of 100 ppm solution (ml)	Volume of Acetonitrile (ml)
1	0.1	9.9
5	0.5	9.5
10	1.0	9.0
15	1.5	8.5
20	2.0	8.0
30	3.0	7.0

Our calibration curve for 3,4-DCA The effect of 3,4-DCA concentration on OD is shown here. (266nm)
A scan was run with the 10ppm solution from 220nm to 300nm to find the wavelength to run the standard solutions on. The peak we got was 266.

Notebook

Week 1

Experiment 1: Revival of Pseudomonas putida culture

Pseudomonas putida culture:

Experiment 2: Inoculation and streak plating of the culture

Pseudomonas putida culture:

Result:

Experiment 3: Confirmatory tests for Pseudomonas putida

Confirmatory tests for Pseudomonas putida

Experiment 4: Primary inoculation for confirmatory tests for Pseudomonas putida

Experiment 5: Primary inoculation for confirmatory tests for Pseudomonas putida

Experiment 6: Confirmatory tests for P. putida (Indole Test)

Pseudomonas putida culture

Experiment 7: Growth curve for P. putida in presence of Acetonitrile

Growth curve of Pseudomonas putida in the presence of Acetonitrile

Week 2

Experiment 8: Growth curve for P. putida in presence of Acetonitrile

Growth curve for growth of Pseudomonas putida in the presence of acetonitrile

Experiment 9: Growth curve for P. putida in presence of Acetonitrile

Growth curves for Pseudomonas putida in the presence of acetonitrile

Experiment 10: Growth curve for P. putida at pH 8.0

Growth curve for Pseudomonas putida at pH 8.0

Experiment 11: Growth curve for P. putida at pH 6.0 and 7.0

Growth curve for Pseudomonas putida at pH 6 and 7

At pH 6:

At pH 7:

Comparisons were drawn between growth curves at different pH levels to determine the optimal pH for growth.

Week 3

Experiment 12: Growth curve for P. putida at 24 and 37 degrees Celsius

The effect of temperature on the growth of Pseudomonas putida was studied:

Comparisons were drawn between growth curves at different temperatures to determine the optimal temperature for growth.

Experiment 13: Growth curve for P. putida at different concentrations of TCC

Growth curves for Pseudomonas putida at different concentrations of TCC

Experiment 14: Reviving of culture for P. fluorescens

Pseudomonas fluorescens culture:

Experiment 15: Inoculation and streak plating of the culture

Pseudomonas fluorescens culture

Experiment 16: Confirmatory tests for P. fluorescens

Confirmatory tests for Pseudomonas fluorescens

Experiment 17: Growth curve of Pseudomonas fluorescens with Acetonitrile

Growth curve for growth of Pseudomonas fluorescens in the presence of Acetonitrile

Week 4

Experiment 18: Growth curve of P. fluorescens at 24 and 30 degrees Celsius

The effect of temperature on the growth of Pseudomonas fluorescens was studied:

Comparisons were drawn between growth curves at different temperatures to determine the optimal temperature for growth.

Experiment 19: Growth curve of P. fluorescens at ph 6.0, 7.0 and 8.0

The effect of pH on the growth of Pseudomonas fluorescens was studied:

Comparisons were drawn between growth curves at different pH levels to determine the optimal pH for growth

Experiment 20: Growth curve of P. fluorescens for determining lag phase

Determination of the lag phase of Pseudomonas fluorescens with two duplicates:

Experiment 21: Growth curve of P. putida at different concentrations of TCC

The effect of various concentrations of TCC on the growth of Pseudomonas putida was observed

Experiment 22: Growth curve of P. fluorescens at different concentrations of TCC

The effect of various concentrations of TCC on the growth of Pseudomonas fluorescens was observed

Week 5

Experiment 23: Revival of Acinetobacter baylyi culture

Acinetobacter baylyi culture:

Experiment 24: Confirmatory Test for A. baylyi

Confirmatory tests for Acinetobacter baylyi:

Experiment 25: Growth curve of A. baylyi in the presence of acetonitrile

The effect of acetonitrile on the growth of Acinetobacter baylyi was observed

Experiment 26: Growth curve of A. baylyi at pH 6.5, 7.5, 8.5

The effect of pH on the growth of Acinetobacter baylyi was observed

At pH 6.5:

At pH 7.5:

At pH 8.5:

Comparisons were drawn between growth curves at different pH levels to determine the optimal pH for growth

Week 6

Experiment 27: Growth curve of A. baylyi at different concentrations of TCC

The effect of different TCC concentrations on the growth of Acinetobacter baylyi was observed.

Comparison of the growth of Pseudomonas putida, Pseudomonas fluorescens and Acinetobacter baylyi at different TCC concentrations

Week 7

Experiment 28: Growth curve of E. coli BL21 with transformed tccA + pET22b+

Week 8

Experiment 29: Growth curve of A. baylyi at 30 and 37 degree celsius

Experiment 30: Growth curve of Pseudomonas putida, Pseudomonas fluorescens, Acinetobacter baylyi for calibrating wet weight

References:

Experiment 1: (C&E) Amplification of tccA gene

Dissolving lyophilized IDT tccA gene fragment

Experiment 2: (C&E) Amplification of tccA gene

**Growth curve of Pseudomonas putida in the presence of Acetonitrile**

**Growth curve for growth of Pseudomonas putida in the presence of acetonitrile**

**Growth curves for Pseudomonas putida in the presence of acetonitrile**

**Growth curve for Pseudomonas putida at pH 8.0**

**Growth curve for Pseudomonas putida at pH 6 and 7**

**The effect of temperature on the growth of Pseudomonas putida was studied:**

**Growth curves for Pseudomonas putida at different concentrations of TCC**

**Growth curve for growth of Pseudomonas fluorescens in the presence of Acetonitrile**

**The effect of temperature on the growth of Pseudomonas fluorescens was studied:**

**The effect of pH on the growth of Pseudomonas fluorescens was studied:**

**Determination of the lag phase of Pseudomonas fluorescens with two duplicates:**

**The effect of various concentrations of TCC on the growth of Pseudomonas putida was observed**

**The effect of various concentrations of TCC on the growth of Pseudomonas fluorescens was observed**

**Confirmatory tests for Acinetobacter baylyi:**

**The effect of acetonitrile on the growth of Acinetobacter baylyi was observed**

**The effect of pH on the growth of Acinetobacter baylyi was observed**

**The effect of different TCC concentrations on the growth of Acinetobacter baylyi was observed.**

**Comparison of the growth of Pseudomonas putida, Pseudomonas fluorescens and Acinetobacter baylyi at different TCC concentrations**

**Primary inoculation of E.coli DH5alpha**