Research Project Goal
Our iGEM project has a primary goal of creating an environmentally friendly and sustainable growth medium for raising bovine muscle cells that do not require fetal bovine serum (FBS). FBS is commonly used in cell culture but has many drawbacks, including ethical concerns, inconsistencies between batches, and the potential transmission of pathogens. Previous research indicates that Wnt3a and Afamin can play essential roles in organoid culture, particularly in the establishment and maintenance of organoids. Therefore, to address these challenges, we focused on developing a genetically engineered HEK293 cell (Afamin and Wnt3a gene-inserted cells) to produce Afamin and Wnt3a-enriched conditioned media, two crucial components that could support cell growth and proliferation without the need for FBS.
Results
Result 1: Cloning BII-CMV-AfmW3A vector and PCR
After purchasing the BII-CMV-AfmW3A plasmid vector, which contains afamin and Wnt3a genes, from AddGene, we transformed this plasmid vector into E. coli DH5alpha to increase the copy number of the plasmid vector. After the plasmid was purified from the E. coli using miniprep, we performed the polymerase chain reaction (PCR) to check whether Afamin and Wnt3a gene sequences were presented in the purified vector. The primer sets targeting Afamin and Wnt3a were used to amplify the genes using the purified BII-CMV-AfmW3A vector as a template.
Three BII-CMV-AfmW3A plasmid vectors were purified from the E.coli. Then, Afamin and Wnt3a genes were amplified using specific primers. The Afamin gene amplified DNA product was designed to be 250 bp. Wnt3a gene amplified DNA product was designed to be 200 bp.
The following primer sequences were used in this experiment:
- Afamin (250 bp)
- Forward primer: 5′ - ATGAGACACTTAAAACTTACAGG - 3′
- Reverse primer: 5′ - GAAGTGTGTTGTCAGCCCAGCAC - 3′
- Wnt3a (200 bp)
- Forward primer: 5′ - ATGGCCCCACTCGGATACTTCTTAC - 3′
- Reverse primer: 5′ - GCCACGCTGGGCATGATCTCCA - 3′
Eight samples were loaded into agarose gel, and it was run for 20 min at 100 V in the agarose electrophoresis tank (Figure 1). The band indicated amplified products. Vector plasmid #2 and #3 bands showed multiple bands of amplified products, which indicates that this vector may be structurally altered or have mutations. However, only vector plasmid #1 products showed clear single-band amplified products in both genes. The band size indicated in Figure 1 showed the exact size of the DNA amplified product from both Afamin (250 bp) and Wnt3a (200 bp). Therefore, we concluded that vector plasmid #1 would be used for the downstream experiments.
Result 2: Engineering HEK293 cells containing Afamin and Wnt3a genes in genomic sequence using DNA plasmid transfection and puromycin selection
Figure 2 illustrates the essential steps involved in the process of creating HEK293 cells capable of producing Afamin and Wnt3a proteins stably. To achieve this, the insertion of the Afamin and Wnt3a genes into the genomic DNA of HEK293 cells requires the transfection of two specific DNA plasmid vectors: the BII-CMV-AfmW3A vector and the Super PiggyBac Transposase Expression vector.
In detail, the procedure begins with the transfection of these two plasmid vectors into HEK293 cells, as shown in Figure 2. The first plasmid vector, BII-CMV-AfmW3A, carries the genetic information for Afamin and Wnt3a, while the second vector, Super PiggyBac Transposase Expression Vector, facilitates the integration of these genes into the cellular genome.
To determine the optimal conditions for the transfection process, we conducted experiments involving two different plasmid vector molar concentration ratios (1:2.5 and 1:5 for BII-CMV-AfmW3A: Super PiggyBac Transposase Expression Vector). These variations were carried out in conjunction with using the lipofectamine transfection reagent. Subsequently, we employed puromycin selection to identify and isolate the HEK293 cells that successfully incorporated and expressed the Afamin and Wnt3a genes. Remarkably, our efforts yielded a successful selection of puromycin-resistant HEK293 cells under both transfection conditions, indicating the establishment of stable Afamin and Wnt3a protein-producing cells.
Figure 3 shows the cellular morphology of HEK293 cells subjected to different experimental conditions, namely the negative control, 1:2.5 transfected sample, and 1:5 transfected sample. These visual observations hold significant implications for our study. After a rigorous two-week treatment with puromycin, we successfully isolated HEK293 cells that had undergone transfection with the BII-CMV-AfmW3A and Super PiggyBac Transposase Expression Vector, employing both the 1:2.5 and 1:5 ratios.
The significance of these findings lies in their role as a critical checkpoint in our research. Cellular morphology serves as an indicator of the overall health and stability of genetically engineered cells. The absence of discernible differences in cell appearance across these experimental conditions is a reassuring outcome, suggesting that the transfection process did not induce any apparent adverse effects or alterations in cellular structure. This preservation of normal cell morphology is a pivotal step towards the establishment of stable HEK293 cell lines capable of producing Afamin and Wnt3a proteins, reinforcing the reliability and potential success of our experimental approach.
Result 3: Quantifying the produced Afamin and Wnt3a proteins in the conditioned media using Bradford Assay and Western Blot
In Figure 4, we employed a BSA (Bovine Serum Albumin) standard curve as a crucial tool for quantifying proteins within our cell culture media. This standard curve served as a reference point against which we measured the protein concentrations present in the media.
The process of quantification involved the utilization of the trendline equation derived from the BSA standard curve. This equation indicates a relationship between the absorbance values obtained from our samples and the corresponding protein concentrations. Using this relationship, we calculated the protein concentrations for each condition tested in our experiment. The results of this quantification revealed the following total protein concentrations within the respective cell culture media conditions:
- Negative control HEK293: 0.81 µg/mL
- 1:2.5 transfected HEK293: 0.79 µg/mL
- 1:5 transfected HEK293: 0.75 µg/mL
These values provide us with critical insights into the protein concentrations associated with different experimental conditions, allowing us to assess the impact of our experimental manipulations on protein levels in the cell culture media.
In Figure 5, we present the quantification results for Afamin and Wnt3a proteins in conditioned media collected during our experiments. To detect these proteins, we employed the western blot technique. In the initial trial, we loaded 1 µg of total proteins per well. Subsequently, in a second trial, we increased the total protein loading to 10 µg per well.
The western blot analysis conclusively demonstrated that the expression of both Afamin (at approximately 75 kDa) and Wnt3a (at approximately 37.5 kDa) proteins was exclusively observed in cells transfected with the vector plasmid. This outcome confirms the successful integration of the target genes into the cellular genome, validating our experimental approach.
Notably, the first trial, which involved the loading of 1 µg of total proteins, yielded very low signal intensities for Afamin and Wnt3a proteins, making accurate quantification challenging. In response to this limitation, we conducted a second trial with a higher protein loading (10 µg per well), aiming to enhance the detection sensitivity and obtain more robust data (Figure 5).
However, it is essential to acknowledge that our study encountered limitations in determining the molar ratio of Afamin and Wnt3a proteins. This limitation arises from the absence of a reference gene for normalization purposes. While our results confirm the presence or absence of these specific proteins, quantifying their exact abundance relative to each other remains a subject for future investigations.
Result 4: Analyzing the effect of Afamin-Wnt3a conditioned media (CM) on Bovine myoblast cell line (MyoB)
Figure 6 presents a comprehensive analysis of the impact of Afamin-Wnt3a conditioned media (CM) on MyoB cell proliferation. To quantify this effect, we utilized the PrestoBlue assay and conducted incubations at five distinct time points: 0 hours, 24 hours, 48 hours, 72 hours, and 96 hours. The accompanying graph displays the mean and standard deviation (SD) of these measurements (N = 2), and we assessed statistical significance using the Mann-Whitney test to calculate p-values. All samples were seeded with the sample number of cells (1.25 x 103 cells).
We harvested the cell culture media derived from our engineered HEK293 cells enriched with the Afamin-Wnt3a complex. Our goal was to assess its impact on the proliferation of bovine myoblast cells (MyoB) via a dedicated cell proliferation assay. In this study, we examined four specific conditions: standard DMEM cell culture media without FBS, standard DMEM cell culture media with 10% FBS, standard DMEM cell culture media with 10% Afamin-Wnt3a CM, and standard DMEM cell culture media without FBS but supplemented with 20% Afamin-Wnt3a CM.
The results, as shown in Figure 6, affirm that Afamin-Wnt3a CM plays a crucial role in regulating MyoB cell proliferation. Remarkably, 10% Afamin-Wnt3a CM led to a significantly enhanced proliferation rate, as evidenced by an absorbance reading of approximately 2.0 A.U (p = 0.0295) compared to the FBS-absent sample. These findings underscore the substantial potential of Afamin-Wnt3a CM in stimulating cell proliferation, with promising implications for cell-based applications and research.
We further hypothesized that increasing the concentration of Afamin-Wnt3a to 20% would result in a more pronounced proliferation increase. However, our observations indicated that elevating Afamin-Wnt3a to 20% did not lead to a substantial boost in cell proliferation (~1.3 A.U.). Additionally, it is worth noting that the proliferation rate was lower when supplementing with Afamin-Wnt3a CM compared to 10% FBS (~4.0 A.U.). This suggests that, at present, 10% FBS cannot be replaced by Afamin-Wnt3a CM supplementation, highlighting the unique roles and potential limitations of these factors in cell culture applications.
Next, we acquired bright field images of MyoB cells after 96 hours of incubation with these four culture media conditions. In the absence of FBS, we noted the lowest cell density, with smaller cell sizes than the other conditions. Conversely, 10% FBS resulted in spindle-shaped cells with robust coverage and density. Interestingly, 10% Afamin-Wnt3a CM treatment led to a morphology similar to that seen with 10% FBS, with a ~50% reduction in cell density compared to the 10% FBS-incubated samples. Notably, in the presence of 20% Afamin-Wnt3a CM, we observed the formation of cell aggregates.
This result suggests that the 20% Afamin-Wnt3a CM treatment may induce the differentiation of MyoB cells, transitioning them from myoblasts to myocytes and myotubes. Consequently, this differentiation process appears to result in a lower cell proliferation rate when compared to the 10% Afamin-Wnt3a CM treatment.
Cultured meat, produced through in vitro cultivation of animal cells, represents a sustainable and environmentally friendly alternative to traditional livestock farming. In this context, bovine cell culture is pivotal in generating lab-grown meat products. The ability to enhance cell proliferation and differentiation, as demonstrated by the effects of Afamin-Wnt3a CM, is critical for advancing the efficiency and scalability of cultured meat production.
Our project showed an increase in cell density and differentiation under the influence of Afamin-Wnt3a CM, which suggests a potential strategy for optimizing the culture conditions of bovine cells used in lab-grown meat production. By carefully modulating the concentration of Afamin-Wnt3a CM in the culture medium, we may achieve the desired characteristics in the final cultured meat product.
Moreover, the findings regarding cell differentiation hint at the possibility of directing bovine cells toward specific lineages relevant to meat production, such as myocytes and myotubes. This could lead to the development of meat products with improved texture, taste, and nutritional profiles, ultimately enhancing the consumer appeal of lab-grown meat.
In summary, these outcomes presented in our project provide valuable insights that can inform and advance the field of bovine cell culture for cultured meat production. The ability to modulate cell behavior through Afamin-Wnt3a CM opens up exciting avenues for optimizing the production process and fine-tuning the characteristics of lab-grown meat, bringing us closer to a sustainable and ethical future in food production.