Material

1. Escherichia coli BL21(DE3): obtained from Dr. Li lab.
2. Escherichia coli DH5α, obtained from Dr. Li lab.
3. BL21/pET28EXba-acc, constructed by this experiment.
4. BL21/pET28EXba-acc-4cl, constructed by this experiment.
5. BL21/pGEXMCM-dcs-curs, constructed by this experiment.

1. acc, sequence obtained from National Center for Biotechnology Information (NCBI).
2. 4cl, sequence obtained from NCBI.
3. dcs, sequence obtained from NCBI.
4. curs, sequence obtained from sequence obtained from NCBI.

Name	Resistance	Size	Source
pET28EXba	Kanamycin	6526 bp	Dr.Li lab
pGEXMCM	Ampicilin	6190 bp	Dr.Li lab
pET28EXba-acc	Kanamycin	6916 bp	This work
pET28EXba-acc-4cl	Kanamycin	8602 bp	This work
pGEXMCM-dcs-curs	Ampicilin	6634 bp	This work

Name	Sequence	Enzyme
dcs-F	ATATGAATTCATGGAAGCGAACGGCTACCG	EcoRⅠ
dcs-R	ATTGTCTAGAGCCAGATCCGTTCAGTCTGCAACTATGGA
curs-F	ACTGAACGGATCTGGCATGGGTAGCCTGCAGGCGATGC
curs-R	TGCGGCCGCTCGAGTCTACGGTATTGGTAGACTGCGTAGC	XbaⅠ
4cl-F	ATGCTCTAGAATGGCGCCACAAGAACAAGC	XbaⅠ
4cl-R	GCGCCTCGAGTCACAATCCATTTGCTAGTT	XbaⅠ
acc-F	CGGCCATATGATGGACGCTTCTATGATTAC	NdeⅠ
acc-R	ATCGCTCGAGACGAGATCTAGACTAAACCGTTGCGTTTGTCAGC	XhoⅠ/XbaⅠ
PGEXMCM-F	GCCTTAAGGAATACTGTTTCCTGTGTGAAATTG	EcoRⅠ
PGEXMCM-R	ATTAAGATCTCTCGAGCGGCCGCATCGTGACTGACTG	XbaⅠ

1. XhoⅠ, purchased from TAKARA Company (CHN).
2. NdeⅠ, purchased from TAKARA Company (CHN).
3. XbaⅠ, purchased from TAKARA Company (CHN).
4. EcoRⅠ, purchased from TAKARA Company (CHN).
5. Ampicilin (Amp), purchased from solarbio Company (CHN).
6. Kanamycin (Kan), purchased from solarbio Company (CHN).

1. Tris-base, purchased from sigma Company (GER).
2. Glycerinum, purchased from sigma Company (GER).
3. NaOH, purchased from Macklin Company (CHN).
4. CaCl2, purchased from APS Company (USA).
5. MgCl2, purchased from APS Company (USA).
6. NaCl, purchased from aladdin Company (CHN).
7. Agar powder, purchased from solarbio Company (CHN).
8. Extraction kit, purchased from Omega Company (USA).
9. Agarose: purchased from Sangon Biotech Company.
10. EDTA, purchased from Sangon Biotech Company (CHN).
11. SDS, purchased from Sangon Biotech Company (CHN).
12. Absolute ethyl alcohol, purchased from Sangon Biotech Company (CHN).
13. 75% ethanol, purchased from Sangon Biotech Company (CHN).
14. Ferulic acid, purchased from MACKLIN Company (CHN).
15. 6×Loading Buffer, purchased from TAKARA Company (CHN).
16. Marker, purchased from TAKARA Company (CHN).

Protocol

1. Alkali lysate I, weighed 3.03 g Tris-base, 2.92 g EDTA, 9.9 g glucose into 1 L H2O, adjusted pH to 8.0, 121 ℃ sterilized for 10 mins then stored at 4 ℃.
2. Alkali lysate II, mixed 0.4mol/L NaOH and 2% SDS in equal volume, while 0.4 mol/L NaOH and 2% were prepared by sterile water respectively and stored at the room temperature.
3. Alkali lysate III, weighed 194.42 g potassium acetate into 800mL steriled water, then 115 mL of acetic acid was added, and finally the volume was fixed to 1 L, stored at 4 ℃.
4. 50% glycerol, equal volume of 100% glycerol and sterile water were mixed and stored at 4℃.
5. 2×GC buffer, added BSA 40 mg, Betaine 24.6 g, Tris-HCl 4 mL at pH 8.8, 1 mol/L KCl 4 mL, 800 μL of 1 mol/L Mg2SO4 at pH 8.8, 12 mL of 0.5 mol/L (NH4)2SO4 at pH 8.8, 24 mL 50% glycerin, 4mL DMSO, 4 mL N, N, N-dimethylformamide, Triton X-100 400 μL, and finally the volume was fixed to 200 mL with sterilized water.
6. 0.8 mol/L Isopropyl-β-D -thiogalactopyranoside (IPTG)：weighed IPTG 2 g, added H2O to 10 mL, then filtered and sterilized and stored at -20 °C.

1. Weighed NaCl 10 g, Tryptone 10 g, Yeast extract 5 g then the volume was fixed to 1 L with ddH2O and adjusted pH to 7.0 with NaOH, sterilized at 121 ℃ for 20 mins, and stored at the room temperature.
2. For solid LB medium, 1.5 g Agar powder was added every 100 mL on the basis of (1).

1. For the liquid medium, the corresponding antibiotics were added at a ratio of 1/1000 before using.
2. For the solid medium, it was heated and melted before using. When the temperature was reduced to about 50-60 ℃, the corresponding antibiotics were added in the proportion of 1/1000, which could be used to make the plate.

1. Placed fresh leaves in a mortar and pestle pre-cooled with liquid nitrogen, and the tissue was ground with a mortar and pestle, with the addition of liquid nitrogen until it was ground to powder, and the sample (50-100 mg) was added to a 1.5sterilized tube containing 450 μL of Butter RL.
2. Centrifuged the lysate at 12000 rpm for 5 min at 4 ℃.
3. Pipetted the supernatant carefully into a new 1.5sterilized tube.

1. Added 1/2 volume of anhydrous ethanol to the supernatant or mixtured from the sample lysis step and mixed with a pipette gun.
2. Immediately transferred the entire mixture to the RNA SC (2 mL tube).
3. Centrifuged at 12000 rpm for 1 min to discard the filtrate and placed the RNA Spin Column back into the 2 mL Collection tube.
4. Added 500 μL of Buffer RW to the RNA Spin Column, centrifuged at 12000 rpm for 30 s and discarded the filtrate.
5. Added 600 μL of Buffer RWB to the RNA Spin Column, centrifuge at 12000 rpm for 30 s, discarded the filtrate.
6. Used DNase I to digest.

Mixed the extracted RNA in the following proportions.

Placed the mixed system in the PCR instrument and ran it (Procedure was to first incubate at 25 ℃ Celsius for 10 mins, then at 50 ℃ Celsius for 30 mins, finally at 85 ℃ Celsius for 5seconds).

1. Preparation 1-reaction PCR mix into the PCR tube by adding together 8.5 µL deionized water, 12.5 µL 2×GC buffer, 2 µL dNTP mix,1 μL templated DNA, 1 μL primer pairs and 0.125 µL rTaq DNA polymerase.
2. Placed the PCR tubes into the PCR apparatus and run it (Protocol can be divided into five centrifuge tubes, pre-denaturation → denaturation → anneal→ extension → final extension). After the PCR program entered denaturation, it run 30 times successively through denaturation, annealed and extension, and finally entered complete extension. After completing extension, waited for the temperature to drop to 16 ℃ to end the pro-gram.
① Pre-denaturation, run at 95 ℃ for 5-10 mins to completely denature the primes, to ensure that the primers were single stranded. Meanwhile, some secondary structures of the template DNA aredestroyed, and the double stranded of the template DNA was fully dissociated.
② Anneal, reduced the solution temperature to the appropriate temperature (determined by annealing temperature pf the primer) and centrifuged it for 20 s to make the template DNA and primer complemented each other according to the principle of base pairing principle.
③ Extension, when the reaction temperature of the solution rose to 72 ℃, the rTaq DNA polymerase took the single strand DNA as the template and centrifuged the complementary DNA in the direction of 5'- 3' by using four kinds of deoxynucleotide triphosphate (dNTP) in the reaction mixture under the guidance of primers. The extension time of the microcenter point ends at the length of the fragment The PCR instrument used in this experiment was extended by 1k bp/min.
④ Final extension, maintained it at 72 ℃ for 8mins to make PCR reaction more completed to improve amplification yield.
⑤ Waited for the temperature to drop to 16 ℃ and the PCR procedure was completed.

All reagent below referent was offered by Extract kit.
1. Added twice the volume of Binding Buffer to the sample, stood at the room temperature for 1 min. Transferred to adsorption column, then centrifuged at a speed of 13000 rcf/min for 1 min and discarded the liquid supernatant of collect column (If the sample was attained from the gel extraction, the volume of Binding Buffer was exceeded the gel).
2. Added 300 μL Binding Buffer to adsorption column, then centrifuged at a speed of 10000rcf/min for 1min and discarded the liquid supernatant of collect column.
3. Added 700 μL Washing Buffer to adsorption column, stood at the room temperature for 2 mins, then centrifuged at a speed of 10000 rcf/min for 1min and discarded the liquid supernatant of collect column (Repeated this step twice).
4. Added nothing to adsorption column, stood at the room temperature for about 5mins, then discarded collect column and transferred adsorption column to a new centrifuge tube.
5. Added 30~50 μL 55 ℃ ddH2O, stood at the room temperature for 1 min and then centrifuged at a speed of 13000 rcf/min for 1 min.
6. Transferred the water in the centrifuge tube to adsorption column and then centrifuged one more time.
7. Discarded the adsorption column and restored the sample at -20 ℃.

1. Activation of glycerol bacteria stock, 5 mL of liquid medium, 5 μL of corresponding antibiotic and 100 μL of glycerol bacteria were added to sterile 30 mL cylindrical glass bottles, and incubated overnight in shaker at 37 ℃, 160 rpm/min.
2. Cultivation of single colonies picked out the single colonies on the plate by a 10 μL tip, and then the tip was put into a 30 mL cylindrical glass bottle with 5 mL liquid medium and 5 μL of corresponding antibiotics. Finally, the 30 mL cylindrical glass bottle was incubated overnight in shaker at 37 ℃, 160 rpm/min.

1. Inoculated E.coli strains containing the plasmid in 5 mL of LB liquid medium with selective antibiotics and then cultured in a shaking table at 37 ℃, 160 rpm for 12-16 h.
2. Transferred the bacterial solution to the micro centrifuge tube, centrifuged it at a speed of 8000 rpm/min at 4 ℃ for 1 min, discarded the liquid supernatant, and under the same conditions until all the bacterial solutions were transferred.
3. Added 100 μL alkali lysate I to the bacteria and suspended fully.
4. Added 200 μL alkali lysate II, slowly inverted mixed, and flicked the bottom, until the solution became clear, then added 150 μL alkali lysate III, reversed and mixed micro centrifuge system, stood at 4 ℃ for 5 mins, then 4 ℃ centrifuged at a speed of 12000 rpm/min for 5 mins.
5. Transferred the liquid supernatant to a clean centrifugal tube, added anhydrous ethanol of 2 times volume of the liquid supernatant, mixed and precipitated at 4 ℃ for 5mins, then centrifuged at a speed of 12000 rpm/min for 5 mins, and discarded the liquid supernatant.
6. Added 500 μL 75% ethanol solution to the precipitation, discarded the liquid supernatant after 4 ℃ centrifuged at a speed of 12000 rpm/min for 2 mins, and placed at the room temperature to volatilize the remaining liquid.
7. Added an appropriate amount of sterile water at about 60 ℃, and the shaker oscillated evenly, and stored the plasmid solution at -20 ℃.

1. Single Enzyme digestion system of plasmid, 80% plasmid, 10% buffer, 5% enzyme, 5% ddH2O.
2. Double Enzyme digestion system of plasmid, 80% plasmid, 10% buffer, 5% enzyme A, 5% enzyme B.
3. Single enzyme digestion system of gene fragment, 80% plasmid, 10% buffer, 2% enzyme, 8% ddH2O.
4. Double enzyme digestion system of gene fragment, 80% gene fragment, 16% buffer, 2% enzyme A, 2% enzyme B.

1. Sample Preparation, added electrophoresis Loading buffer, Gel Loading Dye, Purple (6×) to nucleic acid sample, that was, added 1 part buffer to parts of sample.
2. Agarose gel Preparation, weighed 0.8 g agarose, added 100 mL of TAE(1×) buffer，prepared 0.8% agarose, heated it in a microwave oven for several minutes to completely melted the agarose, mixed it well, poured it into a gel making mold, inserted a comb with a suitable aperture, and after the gel solidified, pulled out the comb and put it into an electrophoretic tank containing TAE(1×) buffer.
3. Electrophoresis, completely immersed the agarose gel in the buffer, added mark and the sample into the loading well, and performed electrophoresis at 120 V for 30 mins.
4. Imaging dyed the electrophoretic gel in EB for 2 mins, then performed UV imaging in the GelDoc Go Imaging System and took photos for recording.

1. Sample Preparation added electrophoretic Loading buffer, Gel Loading Dye, Purple (6×) into the products of endonuclease digestion, that was, added 1 part buffer to 5 parts of sample.
2. Agarose gel Preparation, weighed 0.8 g agarose, added 100 mL of TAE(1×) buffer，prepared 0.8% agarose, heated it in a microwave oven for several minutes to completely melted the agarose, mixed it well, poured it into a gel making mold, inserted a comb with a suitable aperture, and after the gel solidifies, pulled out the comb and put it into an electrophoretic tank containing TAE(1×) buffer.
3. Electrophoresis, completely immersed the agarose gel in the buffer, added mark and the sample into the loading well, and performed electrophoresis at 100 V for 45 mins.
4. Stain placed the gel in 10 μg/mL EB dye solution for 2-4 mins at room temperature.
5. Observation and cutting, observed the electrophoresis tape and its position on the ultraviolet fluoroscope, and cut the fragments in the required range.

1. Enzyme-linked system 1 (total volume 10 μL), 20% plasmid, 60% gene fragment, 10% buffer, 10% T4 DNA ligase.
2. Enzyme-linked system 2 (total volume 10 μL), 40% plasmid, 40% gene fragment, 10% buffer, 10% T4 DNA ligase.
3. Reaction condition, stood at 16 ℃ for 4hours or overnight.

1. A tube of 100 μL DH5α was inoculated in 5mL LB liquid medium and incubated overnight in shaker at 37 ℃, 160 rpm/min.
2. Inoculated the overnight culture in 100 mL of LB medium at 1% ratio and incubated at 37 ℃ for 2-3 h (Cultured to OD600=0.5-0.6).
3. Cooled the bacteria culture in the mixture of ice and water for 5-10 mins in advance. Then transferred the treated bacteria culture to a centrifugal tube and placed it on ice for 10 mins to cool the bacteria liquid.
4. Transferred the cold bacterial liquid into 4 ℃ centrifuged at a speed of 6000 rpm/min for 5 mins. Discarded the liquid supernatant and collected the bacterium.
5. Added 60 mL cold 0.1 mol/L CaCl2 solution to re-suspend the bacterium, and then cooled it in an ice bath for 45 mins.
6. Transferred the bacterial liquid into a 4℃ centrifuged at a speed of 6000rpm/min for 5mins to discard the liquid supernatant and collected the bacterium.
7. Added 1 to 2 mL cold 15% glycerol solution (containing 0.1 mol/L CaCl2 solution) to re-suspend the bacterium and divided them into 300 μL of each micro centrifuge tube and then stored at -80 ℃.

1. Added an appropriate amount of DNA sample or ligated reaction product to 100 μL competent cells, mixed slightly, and took an ice bath for 30 mins.
2. The micro centrifuge system was placed in a water bath at 42 ℃ for 90 s incubation.
3. After incubation, placed the competent cells quickly in the mixture of ice and water for cooling 2 mins, and then added into 800 μL LB liquid medium for shaking culture at 37 ℃ for 45-60 mins.
4. Took out, centrifuged at a speed of 8000 rpm/min for 1 min, removed the liquid supernatant, and left 100 μL.
5. Coated on LB solid plate containing corresponding antibiotics and cultured upside down overnight in 37 ℃ incubator to observe the growth of transformation.

1. Inoculated the glycerol bacteria in 5 mL LB liquid medium containing 1/1000 antibiotics and incubated in a shaking at 37 ℃ and 160 rpm to OD600=0.6.
2. Added 1/1000 of 0.8 mol/L IPTG to the bacteria solution and continued to be cultured in the shaking at 37 ℃ and 160 rpm for 4h to induce the expression of protein.

1. Taked 20 μL of the induced bacterial solution and centrifuged at 8000 rpm for 1 min. Removed the supernatant and added 20 μL H2O for resuspension.
2. Added equal volume of SDS and DTT mixture (mixed volume ratio of SDS: DTT=4:1), incubated in a 100 ℃ metal bath for 10 mins, and then apply the sample.
3. Used SDS-PAGE gel to detect the purity and molecular weight of proteins. The formula of SDS-PAGE gel is as follows: