Targeted SDG goals
3- Good health and well being: The purpose of this expression is to work on the sensitivity and accuracy of our biosensor, whose goal is to detect early stage ovarian cancer.
12- Responsible consumption and production: This goal is met through our experiment as instead of buying the antigens through commercial platforms, we will be expressing the antigens in yeast
15- Life on Land: Since this experiment is done using yeast, it is less harmful for the environment and animal life when put out into the real world.
Overview
We are also working on the expression of the CD44 antigen in yeast cells. This involves the use of Saccharomyces cerevisiae as well as E. coli.
Furthermore, we are working on the expression of antigens in yeast to create a more sustainable way of experimenting. Instead of purchasing antigens, which comes with a lot of other costs, we can simply produce it and use it to experiment on sensitivity and accuracy of our biosensor. This is currently being done digitally, but we intend to move this work into the lab. The process is as follows: first, we streak bacteria on an agar plate to obtain single colonies. Then, we will inoculate a bacterial culture using a single colony from the freshly streaked agar plate to minimize the mixture of plasmids in purified DNA. After this, we will create a yeast strain that produces the CD44 antigen and subsequently express CD44 in the yeast.
This is a biosensor-treatment duo that would be intended for point-of-care usage. The biosensor would detect the ovarian cancer stem cell biomarkers and the engineered CAR T-cell would be used for treatment of ovarian cancer. The antigens expressed in yeast would be used to test the efficacy & sensitivity of our biosensor before introducing it to the market.
While the saccharomyces cerevisiae that we will use is to be grown in isolation, it is possible for it to accidentally enter the environment through contaminated equipment and surfaces. Due to this, any materials that have been in contact with the yeast will be sterilized by an autoclave and surfaces are always thoroughly disinfected. We follow proper sterilization and cleaning protocols.
The Experiment
The goal of this experiment is to express cd44 in yeast and stimulate the cancer stem cells CD44 receptors.
Designing the primers:
Gateway cloning is the method that seems to work
CD44 antigen is inserted in PDonR223 which is a donor vector.
We already have cd44 cloned in pdonr223. We are doing the simulation because we don’t have the plasmid map of the cd 44 inserted in pdonr223. We tried the simulation in geneious and it didn’t work.
After getting the final map of cd 44 inserted in pdonr223, all we need to do is to design primers to bind to attL1 and attL2. And add it to pag416.
The reason to design attL1 and attL2 is because for some weird reason there are no stop codons in the pdonr223 with cd44 that we have. In my primers I added the stop codon in the reverse primer
The primer should be able to insert cd44 gene in pdonr223 plasmid. The result is plasmid (pdonr223 with cd44 with attL sites on 5’ and 3’ of cd44). This plasmid will do a crossover with the yeast plasmid (pag416).
But these are not the primers we’re ordering. These are for simulation and getting the plasmid map. The primers we are ordering will pair to attL sites and amplify cd44 with attL sites. Then weI can add it to the pag416.
After simulation in geneious, it was discovered that because the CD 44 available does not have a stop codon and attL sites are too long for primers to reach the end of the exons of CD44, it was not possible to proceed with gateway cloning. (Gibson cloning worked in the simulation in Benchling.)
The overall process consists of:
Fwd primer: 5’ tggacatgaagattggggtgatcctaactcgagattgaattga 3’
Rev primer: 5’ caatacaataaaataagatctatgccaatggacaagttttggtggca 3’
